<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/21150?offset=410</link>
	<atom:link href="https://bioinformaticsonline.com/related/21150?offset=410" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41843/stringtie-transcript-assembly-and-quantification-for-rna-seq</guid>
	<pubDate>Tue, 09 Jun 2020 05:21:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41843/stringtie-transcript-assembly-and-quantification-for-rna-seq</link>
	<title><![CDATA[StringTie Transcript assembly and quantification for RNA-Seq]]></title>
	<description><![CDATA[<p><strong>StringTie</strong><span>&nbsp;is a fast and highly efficient assembler of RNA-Seq alignments into potential transcripts. It uses a novel network flow algorithm as well as an optional&nbsp;</span><em>de novo</em><span>&nbsp;assembly step to assemble and quantitate full-length transcripts representing multiple splice variants for each gene locus. Its input can include not only alignments of short reads that can also be used by other transcript assemblers, but also alignments of longer sequences that have been assembled from those reads. In order to identify differentially expressed genes between experiments, StringTie's output can be processed by specialized software like&nbsp;</span><a href="https://github.com/alyssafrazee/ballgown">Ballgown</a><span>,&nbsp;</span><a href="http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/index.html">Cuffdiff</a><span>&nbsp;or other programs (DESeq2, edgeR, etc.).</span></p><p>Address of the bookmark: <a href="https://ccb.jhu.edu/software/stringtie/" rel="nofollow">https://ccb.jhu.edu/software/stringtie/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44716/exploring-rna-sequence-analysis-tools-for-every-bioinformatician</guid>
	<pubDate>Fri, 13 Dec 2024 04:03:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44716/exploring-rna-sequence-analysis-tools-for-every-bioinformatician</link>
	<title><![CDATA[Exploring RNA Sequence Analysis: Tools for Every Bioinformatician]]></title>
	<description><![CDATA[<p>RNA sequence analysis has become an essential part of modern biological research. From RNA-seq pipelines to specialized tools for specific RNA types, here's a comprehensive guide to tools you can use to make sense of RNA data.</p><h4><strong>1. RNA-Seq Analysis Pipelines</strong></h4><p>RNA-seq is one of the most popular techniques for studying RNA. These tools streamline processing raw sequence data:</p><ul>
<li><strong>FASTQC</strong>: For quality control of raw RNA-seq reads.</li>
<li><strong>Trimmomatic</strong>: For trimming and filtering RNA-seq reads.</li>
<li><strong>HISAT2/STAR</strong>: High-performance aligners for RNA-seq reads.</li>
<li><strong>FeatureCounts</strong>: For quantifying gene expression.</li>
<li><strong>DESeq2/EdgeR</strong>: For differential expression analysis.</li>
</ul><h4><strong>2. Transcriptome Assembly and Annotation</strong></h4><p>For analyzing transcriptomes from non-model organisms or assembling novel transcripts:</p><ul>
<li><strong>Trinity</strong>: For de novo transcriptome assembly.</li>
<li><strong>StringTie</strong>: For transcript assembly and quantification from RNA-seq alignments.</li>
<li><strong>TransDecoder</strong>: To predict coding regions within assembled transcripts.</li>
<li><strong>TAU</strong>: Tools for annotating non-coding and coding RNAs.</li>
</ul><h4><strong>3. Exploring Non-Coding RNA (ncRNA)</strong></h4><p>Non-coding RNAs play critical regulatory roles. Dedicated tools for studying them include:</p><ul>
<li><strong>Infernal</strong>: For identifying ncRNA sequences based on covariance models.</li>
<li><strong>Rfam</strong>: Database and tools for ncRNA families.</li>
<li><strong>miRDeep</strong>: For identifying microRNAs in RNA-seq datasets.</li>
</ul><h4><strong>4. RNA Structure and Motif Analysis</strong></h4><p>Structural biology of RNA helps in understanding its function:</p><ul>
<li><strong>RNAfold (ViennaRNA)</strong>: Predicts secondary structures from RNA sequences.</li>
<li><strong>RNAstructure</strong>: Tools for RNA secondary structure prediction and analysis.</li>
<li><strong>MEME Suite</strong>: For identifying motifs in RNA sequences.</li>
<li><strong>IntaRNA</strong>: For RNA-RNA interaction prediction.</li>
</ul><h4><strong>5. RNA Editing and Modifications</strong></h4><p>Epitranscriptomics is a growing field focusing on RNA modifications:</p><ul>
<li><strong>REDItools</strong>: For RNA editing analysis.</li>
<li><strong>m6Aboost</strong>: For identifying m6A modifications in RNA.</li>
</ul><h4><strong>6. Long-Read RNA Sequencing Analysis</strong></h4><p>Long-read technologies like Nanopore and PacBio are transforming RNA research:</p><ul>
<li><strong>FLAIR</strong>: For isoform-level analysis of long-read RNA-seq data.</li>
<li><strong>NanoMod</strong>: For detecting modifications in RNA from Nanopore sequencing.</li>
</ul><h4><strong>7. RNA-Protein Interactions</strong></h4><p>To study RNA-protein interactions and complexes:</p><ul>
<li><strong>RBPmap</strong>: For identifying RNA-binding protein motifs.</li>
<li><strong>PARalyzer</strong>: For analyzing PAR-CLIP data.</li>
</ul><h4><strong>8. Functional Enrichment Analysis</strong></h4><p>Understanding biological functions and pathways from RNA-seq data:</p><ul>
<li><strong>getENRICH</strong>: A tool designed for pathway enrichment analysis of non-model organisms (hypergeometric P-value calculation with FDR correction).</li>
<li><strong>ClusterProfiler</strong>: For GO and KEGG pathway enrichment analysis.</li>
</ul><h4><strong>9. Visualization and Data Sharing</strong></h4><p>Presenting and sharing RNA sequence analysis results effectively:</p><ul>
<li><strong>IGV</strong>: Genome browser for visualizing RNA-seq alignments.</li>
<li><strong>Circos</strong>: Circular visualization of RNA-seq data.</li>
<li><strong>DashBio</strong>: A Python library for creating bioinformatics visualizations.</li>
</ul><h4><strong>Conclusion</strong></h4><p>The bioinformatics landscape for RNA sequence analysis is vast, with tools catering to specific needs. Whether you&rsquo;re studying coding RNAs, non-coding RNAs, or exploring RNA-protein interactions, the right tools can transform your data into biological insights.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35747/webinar-on-rna-seq-data-analysis-on-28-feb-2018</guid>
	<pubDate>Thu, 22 Feb 2018 06:38:48 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35747/webinar-on-rna-seq-data-analysis-on-28-feb-2018</link>
	<title><![CDATA[Webinar on RNA-Seq Data Analysis on 28 Feb 2018]]></title>
	<description><![CDATA[<p>Strand NGS is a biologist friendly NGS analysis tool that allows biologists to analyze their data using a very intuitive workflow for the analysis and visualization of RNA-Seq data. This webinar will give an overview of the workflow which includes Transcriptome/ Genome alignment, Differential expression analysis, Splicing events and gene fusion detection. Strand NGS also supports novel discovery like identification of novel genes, exons and novel splice junctions.<br />We will highlight the use of Strand NGS features such as PCA, sample correlation, clustering, Venn diagrams, CVA, UMI support and elastic genome browser used in RNA-Seq workflow that supports large scale RNA-Seq data analysis too. The tool also supports biological contextualization on the set of interesting genes from the data by allowing downstream analysis such as GO and pathway analysis. The product has an option to create pipelines for time consuming jobs which automates analysis and leaves more time for end data interpretation. This webinar will give an overview of the features in the RNA-Seq data analysis workflow in Strand NGS.</p><p>Details:<br /><a href="http://www.strand-ngs.com/webinar_registration">Session 1: </a>28 Feb 2018, 9 AM CET<br /><a href="http://www.strand-ngs.com/webinar_registration">Session 2:</a> 28 Feb 2018, 8 AM PST<br />Register here: http://www.strand-ngs.com/webinar_registration</p><p><span style="font-size: 12.8px;">About Speaker:</span></p><p>Dr. Suman Kapoor, Manager- Application Science at Strand Life Sciences, has over 11 years experience in molecular biology, next-generation sequencing based testing, clinical genomics, and personalized medicine for disease management and prenatal testing. Dr. Suman holds a Ph.D in Molecular and Cell Biology from Indian Institute of Science, Bangalore. Prior to joining Strand NGS team, Suman has worked extensively on protein synthesis in eubacteria and has experience working in CAP and NABL accredited lab validating and interpreting NGS based diagnostic tests.</p>]]></description>
	<dc:creator>Strand</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/32253/webinar-on-fast-and-accurate-dna-variant-calling-on-26-apr-2017</guid>
	<pubDate>Fri, 21 Apr 2017 06:14:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/32253/webinar-on-fast-and-accurate-dna-variant-calling-on-26-apr-2017</link>
	<title><![CDATA[Webinar on Fast and Accurate DNA Variant Calling on 26 Apr 2017]]></title>
	<description><![CDATA[<p>Continuing our&nbsp;<a href="http://www.strand-ngs.com/webinar_registration">DNA-Seq webinar series</a>, we'll present Strand NGS v3.0 best-practices: a workflow that identifies highly accurate variants from raw reads. Our best practices workflow is twice as fast as its GATK counterpart, and results in precision/recall rates of up to 99%/98% on whole exome and whole genome samples. We'll also&nbsp;<a href="http://www.strand-ngs.com/webinar_registration">speak briefly</a>&nbsp;about some of the other features in v3.0 including one-shot pipelines, TSS plots, RNA-Seq performance improvements, and, for the first time, HGVS notations for SNP effect analysis.</p><p>Register here:&nbsp;<a href="http://www.strand-ngs.com/webinar_registration"></a><a href="http://www.strand-ngs.com/webinar_registration">http://www.strand-ngs.com/webinar_registration</a></p>]]></description>
	<dc:creator>Yeshodari</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/860/the-centre-for-bioinformatics-mcb-lab</guid>
  <pubDate>Sun, 14 Jul 2013 12:41:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Centre for Bioinformatics (MCB) Lab]]></title>
  <description><![CDATA[
<p>The Centre for Bioinformatics (MCB) is a diverse collection of professors, postdoctoral fellows, and students, who share a common interest in Bioinformatics.</p>

<p>Research Area</p>

<p>We are interested in the development of the statistics and computational methods for the analysis of this data in breast cancer.<br />We have worked on probabilistic models for subcellular localization, protein-protein interactions, and problems related to chemical genomics.<br />We are interested in the development of bioinformatics/biostatistical methodology in the analysis of epigenetic/epigenomic data.<br />We are interested in integrative bioinformatics approaches to learn the gene, gene products, interactions, and regulatory mechanisms involved in mental retardation.</p>

<p>Link @ http://www.mcgill.ca/mcb/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/872/jayaram-lab</guid>
  <pubDate>Sun, 14 Jul 2013 14:04:37 -0500</pubDate>
  <link></link>
  <title><![CDATA[Jayaram Lab]]></title>
  <description><![CDATA[
<p>Responsible (a) for developing Chemgenome, Bhageerath &amp; Sanjeevini methods &amp; softwares for genome annotation, protein tertiary structure prediction &amp; computer aided drug design respectively, (b) for setting up a multi-teraflop supercomputing facility for Bioinformatics &amp; Computational Biology at IIT Delhi, and (c) for making the hardware and software freely accessible at (www.scfbio-iitd.res.in) to the global scientific user community.</p>

<p>Faculty facilitator/Founder Director for two start-up companies (Leadinvent incubated at IIT, Delhi from 2006-2009 &amp; Novoinformatics, under incubation at IIT Delhi since 2011).</p>

<p>Research Interest <br />Genome Analysis, Protein Structure Prediction and Drug Design.</p>

<p>Link @ http://www.scfbio-iitd.res.in/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/1161/genomics-for-bioinformatician</guid>
	<pubDate>Sat, 20 Jul 2013 07:03:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/1161/genomics-for-bioinformatician</link>
	<title><![CDATA[Genomics for Bioinformatician]]></title>
	<description><![CDATA[<p>Genomics is the study of the genomes of organisms. The field includes intensive efforts to determine the entire DNA sequence of organisms and fine-scale genetic mapping efforts. The field also includes studies of intragenomic phenomena such as heterosis, epistasis, pleiotropy and other interactions between loci and alleles within the genome. In contrast, the investigation of the roles and functions of single genes is a primary focus of molecular biology or genetics and is a common topic of modern medical and biological research. Research of single genes does not fall into the definition of genomics unless the aim of this genetic, pathway, and functional information analysis is to elucidate its effect on, place in, and response to the entire genome's networks.<br /><br />Genomics was established by Fred Sanger when he first sequenced the complete genomes of a virus and a mitochondrion. His group established techniques of sequencing, genome mapping, data storage, and bioinformatic analyses in the 1970-1980s. A major branch of genomics is still concerned with sequencing the genomes of various organisms, but the knowledge of full genomes has created the possibility for the field of functional genomics, mainly concerned with patterns of gene expression during various conditions. The most important tools here are microarrays and bioinformatics. Study of the full set of proteins in a cell type or tissue, and the changes during various conditions, is called proteomics. A related concept is materiomics, which is defined as the study of the material properties of biological materials (e.g. hierarchical protein structures and materials, mineralized biological tissues, etc.) and their effect on the macroscopic function and failure in their biological context, linking processes, structure and properties at multiple scales through a materials science approach. The actual term 'genomics' is thought to have been coined by Dr. Tom Roderick, a geneticist at the Jackson Laboratory (Bar Harbor, ME) over beer at a meeting held in Maryland on the mapping of the human genome in 1986.<br /><br />The outcome of almost two years of intense discussions with literally hundreds of scientists and members of the public, has three major areas of focus: Genomics to Biology, Genomics to Health, and Genomics to Society.<br /><br /><strong><em>Genomics to Biology:</em></strong>&nbsp;<br />The human genome sequence provides foundational information that now will allow development of a comprehensive catalog of all of the genome's components, determination of the function of all human genes, and deciphering of how genes and proteins work together in pathways and networks.<br /><br /><strong><em>Genomics to Health:<br /></em></strong>Completion of the human genome sequence offers a unique opportunity to understand the role of genetic factors in health and disease, and to apply that understanding rapidly to prevention, diagnosis, and treatment. This opportunity will be realized through such genomics-based approaches as identification of genes and pathways and determining how they interact with environmental factors in health and disease, more precise prediction of disease susceptibility and drug response, early detection of illness, and development of entirely new therapeutic approaches.<br /><br /><strong><em>Genomics to Society:</em>&nbsp;<br /></strong>Just as the HGP has spawned new areas of research in basic biology and in health, it has created new opportunities in exploring the ethical, legal, and social implications (ELSI) of such work. These include defining policy options regarding the use of genomic information in both medical and non-medical settings and analysis of the impact of genomics on such concepts as race, ethnicity, kinship, individual and group identity, health, disease, and "normality" for traits and behaviors.<br /><br />This vision for the future of genomics is not just about the NHGRI. It encompasses the whole field of genomics, including the work of all the other Institutes and Centers at the NIH and of a number of other federal agencies. All of the NIH Institutes are already taking full advantage of the sequence and will apply its data to the better understanding of both rare and common diseases, almost all of which have a genetic component. A recent example of the way that the HGP and the knowledge and new technologies it has spawned are already facilitating science is the extremely rapid sequencing by groups in Canada and at the Centers for Disease Control and Prevention (CDC) in Atlanta of the genome of the virus that causes Severe Acute Respiratory Syndrome (SARS). The sequencing of the SARS virus genome provides insight into this new and deadly disease at a speed never before possible in science. In turn, this should lead to the rapid development of diagnostic tests and, in time, vaccines and effective treatments.<br /><br /><strong>Links for the addition material available on Net</strong></p><p><a href="http://pevsnerlab.kennedykrieger.org/bioinformatics/bioinf10_genomes.htm">Genomes and genomics:</a></p><p><a href="http://www.123genomics.com/learning.html">Bioinformatics and Genomics:</a></p><p><a href="http://www.ebi.ac.uk/pdbe/docs/roadshow_tutorial/strgenomics/tutorial.html">Structural genomics tutorial:</a></p><p><a href="http://www.hgu.mrc.ac.uk/Users/Philippe.Gautier/tutorial/index.html">Comparative Genomics Tutorial:</a></p><p><a href="http://www.scfbio-iitd.res.in/tutorial/genomics.html">GENOME TUTORIAL:</a></p><p><a href="http://genomebiology.com/content/pdf/gb-2001-3-1-reviews2001.pdf">Tools and resources for identifying protein families, domains and motifs</a></p><p><a href="http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/tools.shtml">Bioinformatics Tools</a><a href="http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/tools.shtml">&nbsp;<br />Tips, Tutorials, and Terminology for Using Selected Resources in Genome Database Guide:</a></p><p><a href="http://www.doe-mbi.ucla.edu/Reprints/R31%20Strong%20A%20Web-based%20Comparative%20Genomics%20tutorial%20Microbiology%20Eduction%202004.pdf">A Web-Based Comparative Genomics Tutorial for Investigating Microbial Genomes:</a></p><p><a href="http://www.genome.gov/27530225">Free Online Tutorials Teach Anyone How to Use Genome Databases:</a></p><p><a href="http://mkweb.bcgsc.ca/circos/?tutorials">Circos to create concise, explanatory, unique and print-ready visualizations of your data:</a></p><p><a href="http://www.igd.cornell.edu/Comparative%20Genomics/Comparative%20Genomics%20Proj.html">Genomics and Comparative Genomics</a><a href="http://www.igd.cornell.edu/Comparative%20Genomics/Comparative%20Genomics%20Proj.html">&nbsp;Learning Module:</a></p><p><a href="http://psb.stanford.edu/psb10/conference-materials/tutorials/compgen-notes.pdf">Computational Challenges in Comparative Genomics</a></p><p><a href="http://psb.stanford.edu/psb10/conference-materials/tutorials/compgen-notes.pdf">A Tutorial:</a></p><p><a href="http://gramene.agrinome.org/tutorials/modules_tutorial.pdf">A Comparative Genomics Resource for Grains</a>:</p><p><a href="http://www.plantcell.org/cgi/content/full/21/12/3718">PLAZA: A Comparative Genomics Resource to Study Gene and Genome Evolution in Plants:</a></p><p><a href="http://en.wikipedia.org/wiki/VISTA_(comparative_genomics)">VISTA</a><a href="http://en.wikipedia.org/wiki/VISTA_(comparative_genomics)">:</a></p><p>Software for Genomics</p><ol>
<li><strong>Artemis</strong>&nbsp;Artemis is a free genome viewer and annotation tool that allows visualization of sequence features and the results of analyses within the context of the sequence, and its six-frame translation.</li>
<li><strong>Chromas&nbsp;</strong>It will display and prints chromatogram files from ABI automated DNA sequencers, and Staden SCF files which the analysis programs for ALF, Li-Cor and Visible Genetics OpenGene sequencers can create.</li>
<li><strong>Glimmer</strong>&nbsp;A system for finding genes in microbial DNA, especially the genomes of bacteria and archaea.Glimmer (Gene Locator and Interpolated Markov Modeler) uses interpolated Markov models (IMMs) to identify the coding regions and distinguish them from noncoding DN</li>
<li><strong>Glimmer</strong>&nbsp;HMM&nbsp;A fast and accurate gene finder based on a GHMM architecture, developed specifically for eukaryotes. It incorporates splice site models adapted from the GeneSplicer program and uses interpolated Markov models for evaluating the coding regions.</li>
<li><strong>Glimmer</strong>&nbsp;M&nbsp;A gene finder derived from Glimmer, but developed specifically for eukaryotes. It is based on a dynamic programming algorithm that considers all combinations of possible exons for inclusion in a gene model and chooses the best of these combinations. The d</li>
<li><strong>MUMmer</strong>&nbsp;MUMmer is a system for rapidly aligning entire genomes, whether in complete or draft form.</li>
<li><strong>pDRAW</strong>&nbsp;pDRAW32 is being developed as a free time hobby project. It is far from finished, but as it has reached a point where it could be helpful for many labs, it is now available to the scientific community.</li>
<li><strong>Sequin</strong>&nbsp;Sequin is a stand-alone software tool developed by the NCBI for submitting and updating entries to the GenBank, EMBL, or DDBJ sequence databases. It is capable of handling simple submissions that contain a single short mRNA sequence, and complex submissio</li>
<li><strong>Staden&nbsp;</strong>The Staden Package consists of a series of tools for DNA sequence preparation (pregap4), assembly (gap4), editing (gap4) and DNA/protein sequence analysis (spin).</li>
</ol><p>For more software @&nbsp;<a href="http://bioinformaticsonline.com/bookmarks/view/926/list-of-popular-bioinformatics-softwaretools">http://bioinformaticsonline.com/bookmarks/view/926/list-of-popular-bioinformatics-softwaretools</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4003/personalised-medicine-animation</guid>
	<pubDate>Tue, 27 Aug 2013 10:07:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4003/personalised-medicine-animation</link>
	<title><![CDATA[Personalised Medicine - Animation]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/fEY3Khsmuak" frameborder="0" allowfullscreen></iframe>Two animated case scenarios set now and in the future. These highlight potential differences in the way patients are treated now, and how they might be treated as healthcare becomes more tailored.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/1515/list-of-pharmacogenomics-companies-in-india</guid>
	<pubDate>Fri, 09 Aug 2013 13:26:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/1515/list-of-pharmacogenomics-companies-in-india</link>
	<title><![CDATA[List of pharmacogenomics companies in India]]></title>
	<description><![CDATA[<p>pharmacogenomics companies in India are making their good impacts. Here is the list of few pharmacogenomics companies. Please add more if not mentioned here.</p><p>Genomics in India <br /><a href="http://www.ganitlabs.in/">www.ganitlabs.in</a> <br /><a href="http://www.sandor.co.in/">www.sandor.co.in</a> <br /><a href="http://www.igib.res.in/">www.igib.res.in</a> <br /><a href="http://www.genotypic.co.in/">www.genotypic.co.in</a> <br /><a href="http://www.ocimumbio.com/">www.ocimumbio.com</a> <br /><a href="http://www.abcgenomics.com/">www.abcgenomics.com</a> <br /><a href="http://www.xcelrisgenomics.com/">www.xcelrisgenomics.com</a> <br /><a href="http://www.ayugen.com/">www.ayugen.com</a> <br /><a href="http://www.geneombiotech.com/">www.geneombiotech.com</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

</channel>
</rss>