<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/21703?offset=10 https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist Fri, 02 Mar 2018 06:54:15 -0600 https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist <![CDATA[Python learning resources for bioinformatics and computational biologist !]]> Python is a general-purpose language, which means it can be used to build just about anything, which will be made easy with the right tools/libraries.

Professionally, Python is great for backend web development, data analysis, artificial intelligence, and scientific computing. Many developers have also used Python to build productivity tools, games, and desktop apps, so there are plenty of resources to help you learn how to do those as well.

For pros and cons visit http://www.bestprogramminglanguagefor.me/why-learn-python and http://bioinformaticsonline.com/discussion/view/459/python-vs-perl

More resources at https://github.com/CodementorIO/Python-Learning-Resources

Following are the list of useful python programming resources:

]]> Jit https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata Tue, 11 Jun 2019 21:27:10 -0500 https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata <![CDATA[Amity University Bioinformatics Summer Program - Kolkata]]> Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

]]> eliabrodsky https://bioinformaticsonline.com/bookmarks/view/43243/interactive-bioinformatics-resources Thu, 12 Aug 2021 00:09:00 -0500 https://bioinformaticsonline.com/bookmarks/view/43243/interactive-bioinformatics-resources <![CDATA[Interactive Bioinformatics Resources !]]> Learn how to use bioinformatics tools right from your browser.
Everything runs in a sandbox, so you can experiment all you want.

More at sandbox.bio

Address of the bookmark: http://sandbox.bio

]]> Jit https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material Sat, 18 Mar 2023 11:26:18 -0500 https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material <![CDATA[Bioinformatics Training Material !]]> Glittr is a curated list of bioinformatics training material.
All material is:

  • In a GitHub or GitLab repository
  • Free to use
  • Written in markdown or similar

NOTE: This list of courses is selected only based on the above criteria.
There are no checks on quality.

https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

Address of the bookmark: https://glittr.org/?per_page=25&sort_by=stargazers&sort_direction=desc

]]> BioStar https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers Tue, 07 Nov 2023 23:56:30 -0600 https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers <![CDATA[Programming for Lovers !]]> Programming for Lovers (P4❤️) is a free online course that teaches programming using the Go programming language by immersing learners in fun scientific applications.

Each chapter focuses on a single scientific problem and contains a core text accompanied by code alongs and autograded exercises.

You can meet Phillip Compeau in our intro video. Phillip has taught programming at Carnegie Mellon University for years and is a serial online education founder. He is thrilled to bring you this course.

Address of the bookmark: https://programmingforlovers.com/

]]> BioStar https://bioinformaticsonline.com/poll/view/15000/which-mathstatistics-programming-languageapplication-do-you-most-frequently-use-in-bioinformatics Thu, 04 Sep 2014 17:46:41 -0500 https://bioinformaticsonline.com/poll/view/15000/which-mathstatistics-programming-languageapplication-do-you-most-frequently-use-in-bioinformatics <![CDATA[Which math/statistics programming language/application do you most frequently use in bioinformatics?]]> I'm doing a bit more statistical analysis on some bioinformatics things lately, and I'm curious if there are any programming languages that are particularly good for this NGS computation. What suggestions do you guys have? Are there any languages that have exceptionally good libraries?

]]> John Parker https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics Sun, 24 May 2015 09:28:33 -0500 https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics <![CDATA[Perl One liner basics !!]]> Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

]]> Abhimanyu Singh https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl Tue, 09 Jun 2015 23:38:44 -0500 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl <![CDATA[Frequent words problem solution by Perl]]>

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

]]> Jit https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl Wed, 10 Jun 2015 00:17:17 -0500 https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl <![CDATA[Clump Finding Problem Solved with Perl]]> The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

]]> Jit https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud Thu, 20 Aug 2015 02:21:20 -0500 https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud <![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]> InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

]]> Rahul Nayak