<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/22050?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/22050?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/21982/which-bioinformatics-journals-do-you-follow</guid>
	<pubDate>Fri, 10 Apr 2015 12:10:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/21982/which-bioinformatics-journals-do-you-follow</link>
	<title><![CDATA[Which Bioinformatics Journals Do You Follow?]]></title>
	<description><![CDATA[<p><span><span>Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?</span></span></p>]]></description>
	<dc:creator>Tenzin Paul</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</link>
	<title><![CDATA[Pattern Matching Problem Solution with Perl]]></title>
	<description><![CDATA[<p>Problem at http://rosalind.info/problems/1c/</p><p>#Find all occurrences of a pattern in a string.<br />#Given: Strings Pattern and Genome.<br />#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.<br /><br />use strict;<br />use warnings;<br /><br />my $string="GATATATGCATATACTT";<br />my $subStr="ATAT";<br />my $kmer=length($subStr);<br /><br />kmerMatch ($string, $subStr, $kmer);<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />for (my $aa=0; $aa&lt;=(length($string)-$kmer); $aa++) {<br />&nbsp;&nbsp;&nbsp; my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp;&nbsp; if ($myWin eq $myStr) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; #print "$myWin eq $myStr\n";<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; print $aa;<br />&nbsp;&nbsp;&nbsp; }<br />}<br />}</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</guid>
	<pubDate>Thu, 20 Aug 2015 02:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</link>
	<title><![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]></title>
	<description><![CDATA[<p>InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.</p>
<p>With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.</p>
<p>More at https://insidedna.me/</p><p>Address of the bookmark: <a href="https://insidedna.me/" rel="nofollow">https://insidedna.me/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22787/senior-technical-assistant-at-pondicherry-university</guid>
  <pubDate>Wed, 17 Jun 2015 20:46:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Technical Assistant at Pondicherry University]]></title>
  <description><![CDATA[
<p>Senior Technical Assistant</p>

<p>Eligibility : BE/B.Tech(CSE, ECE, IT)</p>

<p>Location : Pondicherry</p>

<p>Last Date : 26 Jun 2015</p>

<p>Hiring Process : Face to Face Interview<br />Pondicherry University - Job DetailsDate of posting:19 May 15</p>

<p>Senior Technical Assistant Job position in Pondicherry University on temporary basis  </p>

<p>Project Title : "Bioinformatics National Certification (BINC) for certifying quality human resource in Bioinformatics"</p>

<p>Qualification : i) B.E/ B.Tech Computer Science/ Electronics &amp; Communication Engineering/ Information Technology with 55% or equivalent marks. ii) One year Experience in relevant field in Government/ Public Sector or reputed Private Organizations. Desirable : Working experience in JSP and ASP/PHP</p>

<p>No. of Post : 01</p>

<p>Department : Biotechnology</p>

<p>Pay : Rs. 27,800/- </p>

<p>Age Limit : 30 Yrs<br />How to apply</p>

<p>Both above-mentioned posts are purely on temporary basis, extended by one year based on performance and will be terminated with the completion of BINC Program at Pondicherry University. Interested Candidates may send their application in the prescribed format with self-attested copies of all mark sheets and certificates to Dr. Basant K. Tiwary, Coordinator (BINC), Centre for Bioinformatics, Pondicherry University, Puducherry-605 014 before June 26, 2015.</p>

<p>Click Here http://www.pondiuni.edu.in/news/requirement-post-one-senior-technical-assistant-one-computer-assistant-–-dept-biotechnologygove</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</guid>
	<pubDate>Tue, 23 Jun 2015 10:55:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</link>
	<title><![CDATA[How long have you been a bioinformatics scientist for?]]></title>
	<description><![CDATA[<p>Most of the researcher have been a scientist whole life, but infact they actually started paying&nbsp; it with at certain time.So, how long have you been in bioinformatics domain now?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</guid>
	<pubDate>Mon, 10 Aug 2015 12:53:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/23680/five-key-traits-to-seek-out-in-potential-bioinformatics-candidates</link>
	<title><![CDATA[Five key traits to seek out in potential bioinformatics candidates !!!]]></title>
	<description><![CDATA[<p>Genomics and proteomics data are being collected in bulk, but mostly, traditional biologist don&rsquo;t know what to do with it. Perhaps this is the reason why (not only this!!! ) computational biologist/bioinformatics scientists are hot commodities in the research world.</p><p>In fact, there are huge demands for expert biological data analyst. It&rsquo;s a fairly new &nbsp;(not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.</p><p>The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.</p><p><img src="http://bioinformaticsonline.com/mod/photo/hire.gif" alt="image" style="border: 0px;"></p><p>Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:</p><p>1. Highly Skilled - programming skills, experience with the biological software and tools.</p><p>The biological data won&rsquo;t illuminate much if the scientist analysing it doesn&rsquo;t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.</p><p>2. Insight - Real vision, robust understanding and deep insight.</p><p>In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.</p><p>3. Energetic &ndash; Curiosity to explore</p><p>Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.</p><p>4. Researcher &ndash; Publications</p><p>Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.</p><p>5. Impressive communicator - Insight that can&rsquo;t be expressed is worthless.</p><p>Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician&nbsp; should know how to present the data and tell a scientific story through numbers/images.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>