<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/22569?</link>
	<atom:link href="https://bioinformaticsonline.com/related/22569?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</link>
	<title><![CDATA[Pattern Matching Problem Solution with Perl]]></title>
	<description><![CDATA[<p>Problem at http://rosalind.info/problems/1c/</p><p>#Find all occurrences of a pattern in a string.<br />#Given: Strings Pattern and Genome.<br />#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.<br /><br />use strict;<br />use warnings;<br /><br />my $string="GATATATGCATATACTT";<br />my $subStr="ATAT";<br />my $kmer=length($subStr);<br /><br />kmerMatch ($string, $subStr, $kmer);<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />for (my $aa=0; $aa&lt;=(length($string)-$kmer); $aa++) {<br />&nbsp;&nbsp;&nbsp; my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp;&nbsp; if ($myWin eq $myStr) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; #print "$myWin eq $myStr\n";<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; print $aa;<br />&nbsp;&nbsp;&nbsp; }<br />}<br />}</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22567/rosalind-problem-solution-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:35:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22567/rosalind-problem-solution-with-perl</link>
	<title><![CDATA[Rosalind Problem Solution with Perl]]></title>
	<description><![CDATA[<p>Rosalind is a platform for learning bioinformatics and programming through problem solving. <a href="http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track">Take a tour</a> to get the hang of how Rosalind works.</p><p>Bioinformatics Textbook Track</p><p>Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track</p><p>I will provide solution of all the Rosalind problem with Perl for community.</p><p>Check out the right sidebar for more links ...</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</guid>
	<pubDate>Sun, 28 Jun 2015 07:46:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</link>
	<title><![CDATA[BioScripts]]></title>
	<description><![CDATA[<p>You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks.</p>
<p>The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.</p>
<p>https://code.google.com/p/biowiki/</p>
<p>https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk</p>
<p>NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&amp;projectsearch=Search+projects</p>
<p>NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&amp;projectsearch=Search+projects</p><p>Address of the bookmark: <a href="https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search" rel="nofollow">https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</guid>
	<pubDate>Thu, 20 Aug 2015 02:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23892/bioinformatics-made-easy-search-bioinformatics-tools-and-run-genomic-analysis-in-the-cloud</link>
	<title><![CDATA[Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud]]></title>
	<description><![CDATA[<p>InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.</p>
<p>With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.</p>
<p>More at https://insidedna.me/</p><p>Address of the bookmark: <a href="https://insidedna.me/" rel="nofollow">https://insidedna.me/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</guid>
	<pubDate>Thu, 22 Jan 2015 22:29:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</link>
	<title><![CDATA[Bioinformatics Scripts]]></title>
	<description><![CDATA[<p>Some of the useful bioinformatics scripts.</p>
<p>For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.</p>
<p>http://milkweedgenome.org/?q=scripts</p><p>Address of the bookmark: <a href="http://milkweedgenome.org/?q=scripts" rel="nofollow">http://milkweedgenome.org/?q=scripts</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/19921/which-of-the-followings-are-the-best-place-to-study-bioinformatics</guid>
	<pubDate>Sun, 28 Dec 2014 00:20:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/19921/which-of-the-followings-are-the-best-place-to-study-bioinformatics</link>
	<title><![CDATA[Which of the followings are the best place to study Bioinformatics ?]]></title>
	<description><![CDATA[<p>Bioinformatics is a major growth area and qualified Bioinformaticians are in high demand. An explosion in biological data has resulted from genome projects, next generation sequencing and other 'omics' techniques. Bioinformatics provides the tools to analyse and exploit such data sets.<br /><br />Can you please suggest me the best place to study bioinformatics ( Grad/PostGrad).</p>]]></description>
	<dc:creator>Reshma Khatun</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22017/binc-2015</guid>
	<pubDate>Sat, 11 Apr 2015 20:35:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22017/binc-2015</link>
	<title><![CDATA[BINC 2015 !!!]]></title>
	<description><![CDATA[<p>Pondicherry University,Puducherry,on behalf of Department of Biotechnology, Government of India, will conduct the BINC examination in2015. The objective of this examination is to certify bioinformatics professionals, trained formally as well as self-trained.Registration will open from March 9,2015 to April 30,2015. Pondicherry University, Puducherry has been identified as a nodal agency by the Department of Biotechnology, Govt. of India to coordinate this examination along with nine centres namely, Pune University, Pune; Anna University, Chennai; Calcutta University, Kolkata; Institute of Bioinformatics &amp; Applied Biotechnology, Bangalore; North-Eastern Hill University, Shillong, University of Hyderabad, Hyderabad; University of Kerala, Thiruvananthapuram; Jawaharlal Nehru University, New Delhi and Assam Agricultural University, Guwahati. In the BINC 2013 examination,17 candidates were certified. DBT has agreed to fund Research fellowships for all the BINC qualified Indian nationals to pursue Ph.D. in Indian Institutes/Universities. Note that the candidate must possess a postgraduate degree(or equivalent) &amp; meet the criteria of the institutes/universities in order to avail research fellowship. In addition, cash prize of Rs. 10,000/- will be awarded to the top 10 BINC qualifiers.</p><p>More at http://www.binc.co.in/College/Index_New.aspx</p><p>BINC notification http://www.binc.co.in/PdfDocuments/Notification.pdf</p><p>Few dates to remember:</p><p>Starting of online submission of application: March 9, 2015<br />Last date for submission of application: April 30,2015<br />Examination consists of two parts:<br />Part I (Paper I) : June 7, 2015 (10 AM-12 PM)<br />Part II ( Paper II &amp; III) :June 28, 2015 (9 AM-12 PM &amp; 2 PM-4 PM)</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>