<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/22570?offset=900</link>
	<atom:link href="https://bioinformaticsonline.com/related/22570?offset=900" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/863/rolland-lagan-lab</guid>
  <pubDate>Sun, 14 Jul 2013 12:57:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rolland-Lagan lab]]></title>
  <description><![CDATA[
<p>The Rolland-Lagan lab at the University of Ottawa is specializing in computational and developmental biology. We use a combination of experimental work, microscopy, image analysis and computer simulations to explore developmental mechanisms in two and three dimensions. </p>

<p>Research Area</p>

<p>Developmental biology, Computational biology, Simulation modeling, Image data analysis</p>

<p>Link @ http://mysite.science.uottawa.ca/arolland/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/28787/various-scholarships-around-the-world</guid>
	<pubDate>Fri, 12 Aug 2016 04:47:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/28787/various-scholarships-around-the-world</link>
	<title><![CDATA[Various scholarships around the world !!]]></title>
	<description><![CDATA[<p>This page provides information on&nbsp;scholarships for&nbsp;developing countries&nbsp; students who are in need of scholarship to study at home and abroad. A scholarship programme is often created to reward students who have worked hard in their career path. Every year prominent Universities and organizations fund scholarships for the students of developing countries to fulfill their dreams of studying at home and overseas for shaping their career perfectly. These scholarships are both fully funded and partially funded. Below weaved list of scholarships for students of developing countries includes all&nbsp;academic&nbsp;levels as&nbsp;undergraduate, graduate, masters,&nbsp;doctoral and postdoctoral students.</p><p><strong><a href="https://www.nottingham.ac.uk/studywithus/international-applicants/scholarships-fees-and-finance/scholarships/masters-scholarships/dev-sol-masters.aspx" target="_blank">Developing Solutions Masters Scholarship at University of Nottingham, UK</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>University of Nottingham<strong><br />Eligible Students:&nbsp;</strong>Applicants are not currently studying at a University of Nottingham campus or are not a University of Nottingham graduate<strong>.</strong><br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing masters degree programme&nbsp;at University of Nottingham.<br /><strong>Award Details:&nbsp;</strong>105 scholarships are available as follows: 30 x 100% tuition fee and 75 x 50% of tuition fees.<br /><strong>Application Deadline:&nbsp;</strong>22 April 2016</p><p><strong><a href="http://www.ed.ac.uk/student-funding/postgraduate/international/region/africa/nyerere" target="_blank">Julius Nyerere Master&rsquo;s Scholarships for Tanzanian Students at University of Edinburgh, UK</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>University of Edinburgh, UK<strong><br />Eligible Students:&nbsp;</strong>Applicants should already have been offered a place at the University of Edinburgh and should have firmly accepted that offer or be intending to do so.<strong><br />Courses:&nbsp;</strong>Scholarship is available for pursuing master&rsquo;s degree at University of Edinburgh.<strong><br />Award Details:</strong>&nbsp;The Julius Nyerere Master&rsquo;s Scholarships will cover the full overseas tuition fee, living costs of &pound;10,000, and a return flight from Tanzania to the UK.<br /><strong>Application Deadline:</strong>&nbsp;1st April 2016</p><p><strong><a href="http://cscuk.dfid.gov.uk/apply/shared-scholarships/info-candidates/" target="_blank">Commonwealth Shared Scholarships in UK, 2016</a><br /></strong><strong>Scholarship Provider:&nbsp;</strong>Commonwealth Scholarship Commission in the United Kingdom (CSC) in partnership with UK universities.<br /><strong>Eligible Students:&nbsp;</strong>Applicant must be a Commonwealth citizen, refugee, or British protected person.<strong><br />Courses:&nbsp;</strong>Scholarships are available for pursuing masters degree program&nbsp;at UK Institutions.<br /><strong>Award Details:&nbsp;</strong>Each Scholarship provides study travel grant towards the costs of study-related travel within the UK or overseas<br /><strong>Application Deadline:&nbsp;</strong>April 1, 2016</p><p><strong><a href="http://www.thehagueuniversity.com/bachelor-studies/admissions-and-finances/financing-your-bachelor-study/talent-scholarship" target="_blank">World Citizen Talent Scholarships for Non-EEA Students</a><br /></strong><strong>Scholarship Provider:&nbsp;</strong>Hague University,&nbsp;Netherlands<strong><br />Eligible Students:&nbsp;</strong>Applicant must enrolling for the first time and have not studied at any programmes of The Hague University of Applied Sciences<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing bachelor degree&nbsp;level at&nbsp;Hague University.<br /><strong>Award Details:&nbsp;</strong>Scholarships&nbsp;each worth&nbsp;EUR 5,000&nbsp;are available to prospective bachelor degree students for the 2016-2017 academic year.<br /><strong>Application Deadline:&nbsp;</strong>31 March 2016</p><p><strong><a href="http://www.ihrp.mahidol.ac.th/index.php/en/academic-admissions/scholarships/137-starting-in-2016-2017-academic-year-emerging-scholar-program-for-master-of-arts-in-human-rights-international-program" target="_blank">IHRP Emerging Scholar Program at Mahidol University</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The Institute of Human Rights and Peace Studies (IHRP),&nbsp;Mahidol University,&nbsp;Thailand<br /><strong>Eligible Students:&nbsp;</strong>Applicant should have very strong English skills.<strong><br />Courses:&nbsp;</strong>Scholarship is available for pursuing MA degree programme.<br /><strong>Award Details:&nbsp;</strong>The scholarship allows for reduced tuition and thesis fees (4,200 Baht per credit to 1,200 Baht per credit each term and a 50 % of the cost of the thesis fee).<br /><strong>Application Deadline:&nbsp;</strong>March 31, 2016</p><p><strong><a href="http://scholarship-positions.com/fig-foundation-phd-scholarships-surveyinggeomatics-academic-programme-denmark/2015/11/21/" target="_blank">2016 FIG Foundation PhD Scholarships for Developing Countries, Denmark</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>FIG Foundation<strong><br />Eligible Students:&nbsp;</strong>Applicants from low-income, lower-middle or upper-middle income economy<strong>&nbsp;</strong>are eligible.<strong><br />Courses:&nbsp;</strong>Scholarships are available for pursuing PhD programme<strong>.</strong><br /><strong>Award Details:&nbsp;</strong>Successful applicants will qualify for a further grant of up to 3,000 euros to attend and present a peer reviewed paper at a FIG conference.<strong>&nbsp;</strong><br /><strong>Application Deadline:&nbsp;</strong>The application deadline is 1 March 2016.</p><p><strong><a href="https://www.humboldt-foundation.de/web/icf.html" target="_blank">International Climate Protection Fellowships for Developing Countries</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Federal Environment Ministry&rsquo;s (BMU) International Climate Initiative<strong><br />Eligible Students:&nbsp;</strong>Applicant should have very good knowledge of English or German<strong><br />Courses:&nbsp;</strong>Fellowships are available for undertaking research in Germany<br /><strong>Award Details:&nbsp;</strong>Fellowship amount according to qualifications between &euro;2,150 and &euro;2,650 per month<br /><strong>Application Deadline:&nbsp;</strong>1 March 2016</p><p><strong><a href="http://www.isunet.edu/admissions/funding-scholarships" target="_blank">International Space University Scholarship Program in France, 2016<br /></a></strong><strong>Scholarship Provider:&nbsp;</strong>The International Space University<strong><br />Eligible Students:&nbsp;</strong>This financial aid is available for applicants from Europe,&nbsp;the United States, Canada and Australia, developing countries and from other countries.<br /><strong>Courses:&nbsp;</strong>Scholarship is available for MSS, SSP and SH-SSP students.<br /><strong>Award Details:&nbsp;</strong>This aid is available to selected applicants, and covers a portion of their tuition fees.<br /><strong>Application Deadline:&nbsp;</strong>MSS&nbsp;applicants:&nbsp;15 March 2016,&nbsp;SSP16 applicants:&nbsp;30 April 2016 and SH-SSP16 applicants:&nbsp;30 November</p><p><a href="https://www.lshtm.ac.uk/study/funding/janssen_pharmaceutica_scholarships_for_msc_global_mental_health.html" target="_blank"><strong>Janssen Pharmaceutica Scholarships for MSc in UK, 2016-2017</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>London School of Hygiene and Tropical Medicine, UK<strong><br />Eligible Students:&nbsp;</strong>Applicants must hold an offer of admission to the MSc Global Mental Health commencing in 2016-17.<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing masters degree&nbsp;at King&rsquo;s College London.<br /><strong>Award Details:&nbsp;</strong>Each scholarship will cover full tuition fees, a living expense stipend of GBP 15,298.00 and an allowance in the summer for project expenses.<br /><strong>Application Deadline:&nbsp;</strong>29 February 2016</p><p><strong><a href="http://www.ox.ac.uk/admissions/undergraduate/fees-and-funding/oxford-support/reach-oxford-scholarship" target="_blank">Reach Oxford Scholarship for Students from Developing Countries</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Oxford University,&nbsp;UK<strong><br />Eligible Students:&nbsp;</strong>This scheme is only suitable for candidates of the highest academic ability who have outstanding examination results.<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing undergraduate&nbsp;degree&nbsp;level at Oxford University.<br /><strong>Award Details:&nbsp;</strong>Scholarship covers University fees and college fees, a grant for living expenses and one return air fare per year.<br /><strong>Application Deadline:&nbsp;</strong>17 February 2016</p><p><a href="https://www.oclc.org/about/awards.en.html" target="_blank"><strong>Jay Jordan IFLA/OCLC Development Fellowship Program, 2017</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>International Federation of Library Associations and Institutions (IFLA) and OCLC<br /><strong>Eligible Students:&nbsp;</strong>Applicant must have a qualifying degree in library or information science.<br /><strong>Courses:&nbsp;</strong>This is a&nbsp;intensive four-week Fellowship program based at OCLC&rsquo;s headquarters in Dublin, Ohio, USA&nbsp;for&nbsp;library and information science professionals.<br /><strong>Award Details:&nbsp;</strong>The award provides each fellow Airfare, coach class, from the recipient&rsquo;s home country to the United States and return trip to the recipient&rsquo;s home country<br /><strong>Application Deadline:&nbsp;</strong>February 12, 2016</p><p><strong><a href="http://scholarship-positions.com/franklin-mosher-baldwin-memorial-fellowships-for-developing-countries/2015/11/29/" target="_blank">Franklin Mosher Baldwin Memorial Fellowships for Developing Countries, 2016<br /></a></strong><strong>Scholarship Provider:&nbsp;</strong>The Leakey Foundation<strong><br />Eligible Students:&nbsp;</strong>Citizens of a developing countries are eligible.<strong><br />Courses:&nbsp;</strong>Fellowships are available for advanced special training or studies leading towards an M.A or PhD.<br /><strong>Award Details:&nbsp;</strong>The maximum award is limited to $15,000 per year.<br /><strong>Application Deadline:&nbsp;</strong>The application deadline is February 15 2016.</p><p><a href="http://www.mids.ch/the-students/financial-aid-scholarships/mids-managed-scholarships.html" target="_blank"><strong>MIDS-Managed Scholarships for Developing Countries</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>Geneva Law School and&nbsp;Graduate Institute of International and Development Studies<br /><strong>Eligible Students:&nbsp;</strong>Demonstrated financial need on the part of candidates as well as their immediate and extended families, employers and any other persons who might otherwise have been able to contribute toward financing their MIDS studies.<br /><strong>Courses:&nbsp;</strong>This scholarship is available for pursuing Master&rsquo;s degree (LLM).<br /><strong>Award Details:&nbsp;</strong>These scholarships cover the total tuition fees as well as CHF 15,000 toward living expenses.<br /><strong>Application Deadline:&nbsp;</strong>1<strong>&nbsp;</strong>February 2016</p><p><a href="http://immana.lcirah.ac.uk/interviewbekelemegersa" target="_blank">IMMANA Postdoctoral Fellowships, 2016</a><br /><strong>Scholarship Provider:&nbsp;</strong>UK Department for International Development (DFID), UK government<br /><strong>Eligible Students:&nbsp;</strong>Eligible applicants will have completed a doctorate (PhD, DPhil, DPH, MD, DVM or similar terminal degree) in any field<br /><strong>Courses:&nbsp;</strong>Fellowships are available for undertaking postdoctoral research programme.<br /><strong>Award Details:&nbsp;</strong>A fixed stipend of &pound;34,000 (approximately $52,000) paid in quarterly installments against satisfactory completion of programme milestones.<br /><strong>Application Deadline:&nbsp;</strong>1&nbsp;February 2016</p><p><strong><a href="http://www.edctp.org/call/edctp-tdr-clinical-research-development-fellowships-2/" target="_blank">2016 EDCTP-TDR Clinical Research and Development Fellowships</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>European &amp; Developing Countries Clinical Trials Partnership (EDCTP) and WHO/TDR.<strong><br />Eligible Students:&nbsp;</strong>Applicant must be a post-graduate (MSc or PhD) or medical graduate with clinical and/or research experience in infectious diseases.<br /><strong>Courses:&nbsp;</strong>Fellowships are available&nbsp;to early to mid-career clinical researchers and&nbsp;key members of clinical trial research teams.<br /><strong>Award Details:&nbsp;</strong>The grant covers one economy class return ticket (home &ndash; host organisation &ndash; home); a monthly stipend; health insurance; an allowance to cover essential educational support materials.<br /><strong>Application Deadline:&nbsp;</strong>28 January 2016 (Stage 1) and&nbsp;21 July 2016 (Stage 2:&nbsp;Training plan &ndash;&nbsp;EDCTP only).</p><p><strong><a href="http://www.unoosa.org/oosa/en/ourwork/psa/bsti/fellowships.html" target="_blank">United Nations/Japan Long-term Fellowship Programme on Nano-Satellite Technologies</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The United Nations Office for Outer Space Affairs and the Government of Japan<br /><strong>Eligible Students:&nbsp;</strong>Be nationals of developing countries or countries with economy in transition; be duly nominated by their institutions.<br /><strong>Courses:&nbsp;</strong>Scholarship is available for pursing PhD students.<br /><strong>Award Details:&nbsp;</strong>The selected candidates will each receive a grant under Japanese government (Mobukagakusho: MEXT) scholarship (Research Students) of about 145,000 yen per month.<strong><br />Application Deadline:&nbsp;</strong>24 January 2016</p><p><strong><a href="http://www.acmedsci.ac.uk/careers/funding-schemes/daniel-turnberg-travel-fellowship/" target="_blank">The Daniel Turnberg UK/Middle East Travel Fellowship Scheme</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Daniel Turnberg Memorial Fund with ongoing support from the Royal College of Physicians, London, the Wellcome Trust and the Wolfson Family Charitable Trust.<strong><br />Eligible Students:&nbsp;</strong>Fellowship is open for medical and non-medical graduates who can show a commitment to a career in research.<br /><strong>Courses:&nbsp;</strong>Travel Fellowship for Medical researchers and bio scientists in the field of biomedical.<strong><br />Award Details:&nbsp;</strong>The Fellowship will cover airfare and a subsistence allowance for a period of up to<strong>four weeks</strong>.<strong>&nbsp;</strong>Funding is provided to an upper limit of&nbsp;&pound;3,500<strong>&nbsp;</strong>per fellowship<strong><br />Application Deadline:&nbsp;</strong>18 January 2016</p><p><a href="http://www.mmmf-grants.org/home/uscanada-program" target="_blank"><strong>MMMF Grants for Women of Developing Countries, 2016</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>Margaret McNamara Memorial Fund<strong><br />Eligible Students:&nbsp;</strong>Demonstrate a commitment to working to empower women and children in developing countries.<br /><strong>Courses:&nbsp;</strong>Grant is available towards the completion of the degree program in Canada and USA.<br /><strong>Award Details:&nbsp;</strong>An MMMF grant covers only a portion of the total costs for an academic year.<br /><strong>Application Deadline:&nbsp;</strong>January 16, 2016</p><p><strong><a href="http://scholarship-positions.com/dorothy-marchus-senesh-fellowship-women-developing-countries-usa/2015/10/14/" target="_blank">Dorothy Marchus Senesh Fellowship for Women from Developing Countries in USA, 2016-2017</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>International Peace Research Association Foundation<strong><br />Eligible Students:&nbsp;</strong>The Dorothy Senesh Fellowships are available to women from developing countries<strong>.</strong><strong><br />Courses:&nbsp;</strong>Fellowships are available for pursuing graduate programme.<br /><strong>Award Details:&nbsp;</strong>The Fellowships provide $5,000 per year for two years for both women, for a total of $10,000 each.<br /><strong>Application Deadline:&nbsp;</strong>Applications are due by January 15, 2016.</p><p><strong><a href="http://iprafoundation.org/senesh-fellowship/" target="_blank">Dorothy Marchus Senesh Fellowship for Women, 2016-2017</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>International Peace Research Association Foundation<strong><br />Eligible Students:&nbsp;</strong>The Dorothy Senesh Fellowships are available to women from developing countries who have completed a Bachelor&rsquo;s degree<br /><strong>Courses:&nbsp;</strong>Fellowships are available for pursuing graduate programme.<strong><br />Award Details:&nbsp;</strong>The Fellowships provide $5,000 per year for two years for both women, for a total of $10,000 each.<br /><strong>Application Deadline:&nbsp;</strong>January 15, 2016</p><p><a href="http://www.ox.ac.uk/admissions/graduate/fees-and-funding/fees-funding-and-scholarship-search/weidenfeld-hoffmann-scholarships-and-leadership-programme/louis-dreyfus-weidenfeld-scholarship-and-leadership-programme" target="_blank"><strong>Louis Dreyfus-Weidenfeld Scholarship in UK, 2016</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>Louis Dreyfus Foundation&nbsp;and University of Oxford, UK<br /><strong>Eligible Students:&nbsp;</strong>This scholarship seeks to support individuals who, following completion of their supported studies, will go on to actively engage in the chosen fields.<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing full time graduate degree at University of Oxford.<br /><strong>Award Details:&nbsp;</strong>The scholarship will cover 100% of University and college fees and a grant for living costs (of at least &pound;14,057).<br /><strong>Application Deadline:&nbsp;</strong>8 or 22 January 2016, depending on your course.</p><p><strong><a href="http://wwf.panda.org/how_you_can_help/volunteer/prince_bernhard_scholarships/" target="_blank">WWF Prince Bernhard Scholarships for Developing Countries</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>WWF,&nbsp;Switzerland<strong><br />Eligible Students:&nbsp;</strong>Applications are encouraged from people seeking to build skills in specific subjects that will enhance their contribution to nature conservation.<strong><br />Courses:&nbsp;</strong>Scholarships are available for pursuing formal studies or professional training.<br /><strong>Award Details:&nbsp;</strong>The maximum amount for any one scholarship under this scheme is CHF 10,000 and preferential consideration is given to requests for less than CHF 10,000.<br /><strong>Application Deadline:&nbsp;</strong>5 January 2016</p><p><strong><a href="http://scholarship-positions.com/jncasr-cics-fellowship-programme-developing-countries-india/2015/10/03/" target="_blank">JNCASR-CICS Fellowship Programme for Developing Countries in India, 2016</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Jawaharlal Nehru Centre for Advanced Scientific Research (JNCASR ) Bangalore and the Centre for International Co-operation in Science(CICS)&nbsp;Chennai,&nbsp;India<strong><br /></strong><strong>Eligible Students:&nbsp;</strong>Citizens of developing countries<strong><br />Courses:&nbsp;</strong>Fellowships are available to undertake research studies (short-term, participatory research) in India.<br /><strong>Award Details:&nbsp;</strong>The Fellowship covers return airfare from place of work in their home country to place of work in India, boarding and lodging at the affiliated institution/s, and an adequate allowance in Indian currency to cover incidental expenses<strong>.</strong><br /><strong>Application Deadline:&nbsp;</strong>The last date for receipt of the applications is 31st October every year.</p><p><strong><a href="http://scholarship-positions.com/ifs-individual-research-grants-citizens-developing-countries/2015/11/26/" target="_blank">IFS Individual Research Grants for Citizens of Developing Countries, 2016</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>International Foundation for Science (IFS)<strong><br />Eligible Students:&nbsp;</strong>Citizens of following developing countries.<strong><br />Courses:</strong>&nbsp;Grants are available for pursuing research programme.<br /><strong>Award Details:&nbsp;</strong>Individual Research grants are awarded on merit in amounts up to USD 12,000 for one to three years.<br /><strong>Application Deadline:&nbsp;</strong>The deadline for submission of research grant applications is 31st December 2015.</p><p><strong><a href="http://www.kuleuven.be/iro/index.html" target="_blank">IRO Doctoral Scholarship for Developing Countries Students in Belgium</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Catholic University of Leuven&rsquo;s&nbsp;Interfaculty Council for Development Cooperation,&nbsp;Belgium<strong><br />Eligible Students:&nbsp;</strong>The candidate must hold an academic qualification at least equivalent to a high distinction.<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing&nbsp;PhD&nbsp;program&nbsp;at KU Leuven<br /><strong>Award Details:&nbsp;</strong>The scholarship includes monthly basic amount&nbsp;&euro; 1,415 (75% of the net salary of an assistant) paid at the end of each month&nbsp;for doctoral students&nbsp;and&nbsp;&euro;1000 paid at the beginning of each month<br /><strong>Application Deadline:&nbsp;</strong>November 9th</p><p><a href="http://cscuk.dfid.gov.uk/apply/split-site-scholarships/" target="_blank"><strong>Commonwealth Split-site (PhD) Scholarships for Developing Countries, 2016</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>UK Department for International Development (DFID)<strong><br />Eligible Students:&nbsp;</strong>Be registered for a PhD at a university in your home country<br /><strong>Courses:&nbsp;</strong>Scholarships are available for pursuing Split-site (PhD)<strong><br />Award Details:&nbsp;</strong>Each scholarship provides study travel grant towards the costs of study-related travel within the UK or overseas<br /><strong>Application Deadline:&nbsp;</strong>19 November</p><p><a href="http://cscuk.dfid.gov.uk/apply/medical-fellowships/" target="_blank"><strong>2016 Commonwealth Medical Fellowships in UK</strong><strong><br /></strong></a><strong>Scholarship Provider:&nbsp;</strong>UK Department for International Development (DFID)<strong><br />Eligible Students:&nbsp;</strong>Applicant must have qualified as a doctor or dentist between 1 October 2006 and 30 September 2009, or before 1 October 2001<br /><strong>Courses:&nbsp;</strong>Fellowships are available&nbsp;to doctors and dentists to enable them to spend between three and six months at a UK hospital.<br /><strong>Award Details:&nbsp;</strong>Each fellowship provides research support grant, payable to your host university hospital<br /><strong>Application Deadline:&nbsp;</strong>19 November</p><p><strong><a href="http://cscuk.dfid.gov.uk/apply/academic-fellowships/" target="_blank">Commonwealth Academic Fellowships for Mid-Career Academics in UK, 2016</a><br />Scholarship Provider:&nbsp;</strong>UK Department for International Development (DFID)<strong><br />Eligible Students:&nbsp;</strong>Applicant must be permanently resident in a developing Commonwealth country<br /><strong>Courses:&nbsp;</strong>Fellowships are awarded for&nbsp;early career&nbsp;academics to spend three months&nbsp;undertaking research and updating their skills&nbsp;at any approved UK university or higher education institution.<br /><strong>Award Details:&nbsp;</strong>Each fellowship provides grant towards the cost of preparing reports and other written work<br /><strong>Application Deadline:&nbsp;</strong>19 November</p><p><strong><a href="http://www.unep.org/provia/ACTIVITIES/FellowshipProgramme/tabid/794421/Default.aspx" target="_blank">PROVIA Visiting Fellowship Programme</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The Global Programme of Research on Climate Change Vulnerability, Impacts and Adaptation (PROVIA) and START<br /><strong>Eligible Students:&nbsp;</strong>The fellowship is open to professionals and researchers whose work involves designing, implementing, or promoting adaptation solutions.<br /><strong>Courses:</strong>&nbsp;Fellowship is available for<strong>&nbsp;</strong>four weeks residential&nbsp;programme at the host institution.<br /><strong>Award Details:</strong>&nbsp;It provides travel (airfare, visa application fee, and airport transfer) and accommodation (housing, daily subsistence allowance) expenses for this fellowship will be covered.<br /><strong>Application Deadline:</strong>&nbsp;20 November</p><p><strong><a href="http://coady.stfx.ca/themes/women/gcl/" target="_blank">Global Change Leaders Scholarship Program for Developing Countries</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The Coady International Institute, St. Francis Xavier University<br /><strong>Eligible Students:&nbsp;</strong>This program is targeted to emerging women leaders from developing countries who are working on development issues<br /><strong>Courses:&nbsp;</strong>It&nbsp;is a seven-week education program at Coady Institute&rsquo;s International Centre for Women&rsquo;s Leadership.<br /><strong>Award Details:&nbsp;</strong>The Global Change Leaders program provides successful candidates with a full scholarship that includes tuition, travel, accommodations, and meals.<br /><strong>Application Deadline:&nbsp;</strong>December 4</p><p><strong><a href="http://www.brookings.edu/about/employment/fellowship/2015/gbl15169" target="_blank">Center for Universal Education Echidna Global Program, 2016</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The Center for Universal Education, Brookings Institution, USA<br /><strong>Eligible Students:&nbsp;</strong>Applicants should have a background in education, development, economics, or a related area, with at least 15 years of professional experience<br /><strong>Courses:&nbsp;</strong>Scholarship is available for undertaking research at the Brookings Institution.<br /><strong>Award Details:&nbsp;</strong>Applicants selected for the fellowship will receive a living stipend of USD $5,000 a month (subject to U.S. tax withholding), paid housing for the four-and-a-half month term, and round-trip travel expenses.<br /><strong>Application Deadline:&nbsp;</strong>November 30</p><p><a href="http://training.iarc.fr/en/fellowships/postdoc.php" target="_blank"><strong>2016 IARC Postdoctoral Fellowships in Cancer Research, France</strong><br /></a><strong>Scholarship Provider:&nbsp;</strong>The International Agency for Research on Cancer (IARC)<br /><strong>Eligible Students:&nbsp;</strong>Candidates are required to have finished their doctoral degree (Ph.D.) within five years of the closing date.<br /><strong>Courses:&nbsp;</strong>Fellowships are available&nbsp;for postdoctoral researchers to complete their training at the IARC in France.<br /><strong>Award Details:&nbsp;</strong>The annual stipend is currently 33 000 Euros and will be paid monthly in advance.<br /><strong>Application Deadline:</strong>&nbsp;30 November</p><p><a href="http://www.isdb.org/irj/portal/anonymous?NavigationTarget=navurl://744f417a19ed335f9f3f27decc21e0c4" target="_blank"><strong>Islamic Development Bank Prize</strong><strong><br /></strong></a><strong>Scholarship Provider:&nbsp;</strong>Islamic Development Bank<strong><br />Eligible Students:&nbsp;</strong>Applicant must have engage in activities and /or reside in one of the IDB member countries or in a Muslim community in non-member countries.<br /><strong>Courses:&nbsp;</strong>Prize is available for women who have&nbsp;developed or be actively involved in projects/activities that are innovative and helped to improve&nbsp;access to safe and affordable water<br /><strong>Award Details:&nbsp;</strong>The Prize consists of two cash awards-U.S. $ 50,000 for a woman or a group of women and U.S. $ 100,000 for an organization.<strong><br />Application Deadline:&nbsp;</strong>30th November</p><p><strong><a href="http://www.facultyforthefuture.net/" target="_blank">Schlumberger Foundation Faculty for the Future Fellowships, 2016</a><br />Scholarship Provider:&nbsp;</strong>The Schlumberger Foundation<strong><br />Eligible Students:&nbsp;</strong>Fellowship applicants should have a proven track record of teaching experience or can demonstrate commitment to teaching.<br /><strong>Courses:&nbsp;</strong>Fellowships are available to pursue PhD or postdoctoral studies at leading universities abroad.<br /><strong>Award Details:&nbsp;</strong>Faculty for the Future grants are based on actual costs for eligible expenses up to a maximum of USD 50,000 per year and may be renewed through to completion of studies<br /><strong>Application Deadline:&nbsp;</strong>November 13th</p><p><strong><a href="https://www.ictp.it/research/math/fellowships.aspx" target="_blank">Mathematics Research Fellowships for Developing Countries</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The Abdus Salam International Centre for Theoretical Physics (ICTP)<br /><strong>Eligible Students:&nbsp;</strong>Visiting Fellows must have a PhD in mathematics prior to the start of their Fellowship.<strong><br />Courses:&nbsp;</strong>These visiting Fellowships are open to mathematicians&nbsp;for pursuing research programme at ICTP.<br /><strong>Award Details:&nbsp;</strong>A&nbsp;small number of visiting fellowships will be awarded.<br /><strong>Application Deadline:&nbsp;</strong>15 December</p><p><strong><a href="http://twas.org/opportunities/fellowships" target="_blank">TWAS-icipe Fellowship Program</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>The International Centre of Insect Physiology and Ecology (icipe)<br /><strong>Eligible Students:&nbsp;</strong>Applicant must be permanent residents in a developing country (other than Kenya)<br /><strong>Courses:&nbsp;</strong>Fellowships are available for undertaking&nbsp;PhD or postdoctoral&nbsp;studies.<strong><br />Award Details:&nbsp;</strong>Icipe will provide a standard monthly allowance which should be used to cover living costs, such as accommodation, food and health insurance.<br /><strong>Application Deadline:&nbsp;</strong>15th September</p><p><strong><a href="http://www.theisn.org/programs/fellowship-program?showall=&amp;limitstart=" target="_blank">ISN Fellowship Program for Developing Countries&rsquo; Students</a><br />Scholarship Provider:&nbsp;</strong>International Society of Nephrology<strong><br />Eligible Students:&nbsp;</strong>The candidates with the highest scores will be granted a fellowship.<br /><strong>Courses:&nbsp;</strong>Fellowship program provides relevant and contemporary nephrology training to physicians.<br /><strong>Award Details:&nbsp;</strong>The total sum of the grant is in alignment with the length of the training and varies according to the anticipated expenses in the host country, as per World Bank data.<br /><strong>Application Deadline:&nbsp;</strong>May 1st or October 1st</p><p><strong><a href="http://twas.org/opportunities/fellowships" target="_blank">TWAS-CSIR Fellowship Programme</a></strong><br /><strong>Scholarship Provider:&nbsp;</strong>Council of Scientific and Industrial Research, India<strong><br />Eligible Students:&nbsp;</strong>Hold a PhD degree in a field of science or technology.<br /><strong>Courses:&nbsp;</strong>Fellowships are available for pursuing research at postgraduate and postdoctoral level at&nbsp;laboratories and institutes<br /><strong>Award Details:&nbsp;</strong>CSIR will provide a monthly stipend to cover for living costs, food and health insurance<br /><strong>Application Deadline:&nbsp;</strong>31st August of each year</p><p><strong><a href="http://www.sfiar.ch/award.htm" target="_blank">SFIAR Awards for Developing Countries Students in Switzerland<br /></a></strong><strong>Scholarship Provider:&nbsp;</strong>The Swiss Forum for International Agricultural Research (SFIAR)<br /><strong>Eligible Students:&nbsp;</strong>Applicant has appropriate linkages in developing countries<strong>.<br />Courses:&nbsp;</strong>This award is available for pursuing&nbsp;PhD or postdoctoral level.<br /><strong>Award Details:&nbsp;</strong>The prize sum of the SFIAR Award is CHF 5&rsquo;000 for a PhD or Post Doc project and CHF 10&rsquo;000 for a team project.&nbsp;<strong><br />Application Deadline:&nbsp;</strong>20 November</p><p><strong><a href="https://ish.org.uk/student-zone/scholarship/" target="_blank">International Students House Residential Scholarships<br /></a></strong><strong>Scholarship Provider:&nbsp;</strong>(ISH)&nbsp;International&nbsp;Students House<strong><br />Eligible Students:&nbsp;</strong>Students should be from a developing or emerging country and intending to return on completion of their studies.<br /><strong>Courses:&nbsp;</strong>This is a two year residential scholarship program for postgraduate students.<br /><strong>Award Details:&nbsp;</strong>ISH&nbsp;provides a range of residential scholarships which provide free accommodation at ISH for up to a year and in exceptional circumstances up to three years.<strong>&nbsp;</strong><br /><strong>Application Deadline:&nbsp;</strong>30 June</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/1182/installing-perl-gd-module</guid>
	<pubDate>Mon, 22 Jul 2013 14:02:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/1182/installing-perl-gd-module</link>
	<title><![CDATA[Installing Perl GD Module]]></title>
	<description><![CDATA[<div><p>In comparative genome analysis work, we usually compare more than two genomes and looks for syntenic regions amongst them. In my research I used Evolution Highway (RH) <a href="http://eh-demo.ncsa.uiuc.edu/">http://eh-demo.ncsa.uiuc.edu/</a>, which is a collaborative project designed to provide a visual means for simultaneously comparing genomes of multiple amniote species. The tool removes the burden of manually aligning these maps and allows cognitive skills to be used toward something more valuable than preparation and transformation of data. In addition to EH, attractive Circos (<a href="http://circos.ca/">http://circos.ca/</a>) is also very popular for this kind of analysis.</p><p>The EH is available online, and can be easily access and use, whereas Circos installation is not entirely straightforward. One of the most difficult parts of the installation involves installing the GD library. Since there weren't good instructions for installing this library on the internet I decided to post instructions here in case they are useful to anyone else.</p><p><strong>Following are the steps to install GD modules in Mac OS</strong><br /><br />1. Setup<br /><br />Create a folder for the files:<br /><br />$ mkdir -p /SourceCache<br />$ cd /SourceCache<br /><br />Get and unpack the required Jpeg-6b and GD libraries:<br />Download Jpeg-6b (<a href="http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&amp;can=2&amp;q">http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&amp;can=2&amp;q</a>)<br />Download GD (<a href="http://search.cpan.org/%7Elds/GD-2.46/">http://search.cpan.org/~lds/GD-2.46/</a>)<br /><br />Place the "tar.gz" files in "/SourceCache" and double click to unpack.<br /><br />2. Install libjpeg<br /><br />Copy the "config.sub" and "config.guess" files to "/SourceCache". Note that your "config.sub" and ""config.guess" files may be in a slightly different location. The commands below show where they were on my machine:<br /><br />$ cd /SourceCache/jpeg-6b/src<br />$ cp /usr/share/libtool/config/config.sub .<br />$ cp /usr/share/libtool/config/config.guess .<br /><br />Configure libjpeg as follows. Note that this was installed on a 64 bit machine. However, this method may configure it in a 32 bit format. This may not be the best way to configure the installation but it works.<br /><br />$ .configure --enable-shared<br />$ make<br /><br />Check to see if the following directories exist on your machine. Create the missing directories in the following manner:<br /><br />$ mkdir -p /usr/local/include<br />$ mkdir -p /usr/local/bin<br />$ mkdir -p /usr/local/lib<br />$ mkdir -p /usr/local/man/man1<br /><br />Finish making and installing libjpeg:<br /><br />$ make install<br /><br />3. Install GD<br /><br />$ cd /SourceCache/GD-2.46/GD/<br />$ perl Makefile.PL<br />$ make<br />$ make test (optional)<br />$ make html (optional)<br />$ make install</p><p><strong>Other way for Mac OS</strong><br />The easiest way to get a lot of these is with a program called Fink, which is similar in nature to the CPAN installer, but installs common GNU utilities. Fink is available from &lt;<a href="http://sourceforge.net/projects/fink/%3E">http://sourceforge.net/projects/fink/&gt;</a>.<br /><br />Follow the instructions for setting up Fink. Once it's installed, you'll want to run the following as root: fink install gd<br /><br />It will prompt you for a number of dependencies, type 'y' and hit enter to install all of the dependencies. Then watch it work.<br /><br />To prevent creating conflicts with the software that Apple installs by default, Fink creates its own directory tree at /sw where it installs most of the software that it installs. This means your libraries and headers for libgd will be at /sw/lib and /sw/include instead of /usr/lib and /usr/local/include. Because of these changed locations for the libraries, the Perl GD module will not install directly via CPAN, because it looks for the specific paths instead of getting them from your environment. But there's a way around that :-)<br /><br />Instead of typing "install GD" at the cpan&gt; prompt, type look GD. This should go through the motions of downloading the latest version of the GD module, then it will open a shell and drop you into the build directory. Apply below patch to the Makefile.PL file (save the patch into a file and use the command patch &lt; patchfile.)<br /><br />Then, run these commands to finish the installation of the GD module:<br /><br />perl Makefile.PL<br />make<br />make test<br />make install<br />And don't forget to run exit to get back to CPAN.</p><p>&nbsp;</p><p><strong>Install on MS Window, using PPM</strong></p><p>C:\Documents and Settings\Owner&gt;ppm<br />PPM interactive shell (2.2.0) - type 'help' for available commands.<br />PPM&gt; install GD<br />Install package 'GD?' (y/N): y<br />Installing package 'GD'...<br />Downloading <a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>. ...<br />Installing C:\Perl\site\lib\auto\GD\GD.bs<br />Installing C:\Perl\site\lib\auto\GD\GD.dll<br />Installing C:\Perl\site\lib\auto\GD\GD.exp<br />Installing C:\Perl\site\lib\auto\GD\GD.lib<br />Installing C:\Perl\html\site\lib\GD.html<br />Installing C:\Perl\site\lib\GD.pm<br />Installing C:\Perl\site\lib\qd.pl<br />Installing C:\Perl\site\lib\auto\GD\autosplit.ix<br />PPM&gt;<br /><br /><br />If you can't install it from ppm. You can download it:<br /><a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>.<br /><br /><br />BTW,All Perl 5.6.1 Modules are located at:<br /><br /><a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>.</p><p>&nbsp;</p><p><strong>Install the Perl GD Module on Linux</strong><br /><br />$ sudo perl -MCPAN -e shell<br /><br />Since it was the first time I had run this command on this particular machine I had to answer a lot of questions but simply selected the defaults for everything as this usually works for me. Once in the CPAN shell I entered<br /><br />$ install Bundle::CPAN<br /><br />and selected all of the defaults again. Once the CPAN bundle had finished installing I tried to install GD::Graph by typing<br /><br />$ install GD::Graph<br /><br />but it failed with hundreds of errors &ndash; the first of which was<br /><br />GD.xs:7:16: error: gd.h: No such file or directory<br /><br />This was fixed with the following apt-get command (in the bash shell)<br /><br />$ sudo apt-get install libgd2-xpm-dev<br /><br />back in the CPAN shell I still couldn&rsquo;t get GD::Graph to build and I guessed this was because of some left over files from the failed build. I don&rsquo;t know the command to clean things up inside the CPAN shell and am too lazy to read the docs so I simply went into the .cpan/build directory in my home directory and deleted anything that started with GD &ndash; eg<br /><br />$ rm -rf GD-2.35-HC_vkB<br /><br />$ rm -rf GDGraph-1.44-Evfibe<br /><br />and so on. Those strings at the end (VkB and so on) look random so they might be different on your machine. Then I went back into the CPAN shell and ran<br /><br />$ install GD::Graph<br /><br />There were a few dependencies which the script fetched and installed for me but everything worked smoothly.</p><p>Manual and other Perl Module instalation are mentioned in my previous blog @ <a href="http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways">http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</a></p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</guid>
	<pubDate>Wed, 14 Aug 2013 14:57:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</link>
	<title><![CDATA[Citrus Perl]]></title>
	<description><![CDATA[<p>Citrus Perl is a binary distribution of Perl created for GUI application developers. The distribution includes <a href="http://wxperl.sourceforge.net">wxPerl</a>, the Perl wrapper for <a href="http://www.wxwidgets.org">wxWidgets</a>. Where supported by the operating system wxWidgets is available as a package for the 2.8.x stable branch and the 2.9.x development branch.</p><p>Address of the bookmark: <a href="http://www.citrusperl.com/" rel="nofollow">http://www.citrusperl.com/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</guid>
	<pubDate>Thu, 26 Sep 2013 15:02:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</link>
	<title><![CDATA[Detect the sequence pattern and its location in fasta file with match and mismatches information.]]></title>
	<description><![CDATA[<p>This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..</p><p>To run:</p><p>perl centro.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4882" length="3596" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12111/internship-program-with-arraygen-technolgies</guid>
  <pubDate>Sun, 22 Jun 2014 23:18:31 -0500</pubDate>
  <link></link>
  <title><![CDATA[Internship program with ArrayGen Technolgies]]></title>
  <description><![CDATA[
<p>Internship Program for Bioinformatics / Biotechnology Professionals Currently we offer positions to outstanding students interested in Next Generation Sequencing (NGS) data analysis. Applications are accepted throughout the year. Accepted students will be listed on web with their schedules. Accepted students can attend our future workshops and trainings freely at the specified venue.</p>

<p>Interested candidates may email their resume along with a cover letter to careers@arraygen.com</p>

<p>Official website: http://www.arraygen.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</guid>
	<pubDate>Tue, 28 Jan 2020 05:37:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</link>
	<title><![CDATA[The Raku Programming Language]]></title>
	<description><![CDATA[<p><span>Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.</span><span>&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://www.raku.org/">https://www.raku.org/</a></span></p><p>Address of the bookmark: <a href="https://www.raku.org/" rel="nofollow">https://www.raku.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>