<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/2261?offset=720</link>
	<atom:link href="https://bioinformaticsonline.com/related/2261?offset=720" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</guid>
	<pubDate>Fri, 04 May 2018 19:43:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</link>
	<title><![CDATA[Popular bioinformatics educational resources !]]></title>
	<description><![CDATA[<p>Followings are the list of popular bioinformatics educational resources</p><p><a href="http://Bii.a-star.edu.sg"><strong>Bii.a-star.edu.sg</strong></a></p><p>Bio research and development. Has course information and research information.</p><p><a href="http://Isb-sib.ch"><strong>Isb-sib.ch</strong></a></p><p>SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.</p><p><a href="http://Bioinformatics.ca"><strong>Bioinformatics.ca</strong></a></p><p>Provides information about bioinformatics in Canada. Workshops, certification and resources.</p><p><a href="http://Chickscope.beckman.uiuc.edu"><strong>Chickscope.beckman.uiuc.edu</strong></a></p><p>Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.</p><p><a href="http://Bcb.iastate.edu"><strong>Bcb.iastate.edu</strong></a></p><p>Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).</p><p><a href="http://Bu.edu/bioinformatics/"><strong>Bu.edu/bioinformatics/</strong></a></p><p>Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.</p><p><a href="http://Bioinformatics.ubc.ca"><strong>Bioinformatics.ubc.ca</strong></a></p><p>A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.</p><p><a href="http://Openhelix.com"><strong>Openhelix.com</strong></a></p><p>Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.</p><p><a href="http://Igb.uci.edu"><strong>Igb.uci.edu</strong></a></p><p>Specializing in making publicly available software and database services for computational biology.</p><p><a href="http://Bioinformatics.pe.kr"><strong>Bioinformatics.pe.kr</strong></a></p><p>Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.</p><p><a href="http://Groups.yahoo.com/group/bimatics/"><strong>Groups.yahoo.com/group/bimatics/</strong></a></p><p>Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.</p><p><a href="http://Ncbi.nlm.nih.gov/books/NBK22183/"><strong>Ncbi.nlm.nih.gov/books/NBK22183/</strong></a></p><p>Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.</p><p><a href="http://Bioinfo.mbb.yale.edu/mbb452a/2003/"><strong>Bioinfo.mbb.yale.edu/mbb452a/2003/</strong></a></p><p>Bioinformatics course at Yale University. All course slides are available online.</p><p><a href="http://Cs.iastate.edu/~honavar/comp-bio-courses.html"><strong>Cs.iastate.edu/~honavar/comp-bio-courses.html</strong></a></p><p>Listing of computational molecular biology course pages that have extensive online course materials.</p><p><a href="http://Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html"><strong>Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html</strong></a></p><p>A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.</p><p><a href="http://Northeastern.edu/bioinformatics/"><strong>Northeastern.edu/bioinformatics/</strong></a></p><p>From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.</p><p><a href="http://Biocomp.unibo.it/lsbioinfo/"><strong>Biocomp.unibo.it/lsbioinfo/</strong></a></p><p>A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.</p><p><a href="http://Cs.helsinki.fi/bioinformatiikka/mbi/programme.html"><strong>Cs.helsinki.fi/bioinformatiikka/mbi/programme.html</strong></a></p><p>A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.</p><p><a href="http://Ornl.gov/sci/techresources/Human_Genome/education/education.shtml"><strong>Ornl.gov/sci/techresources/Human_Genome/education/education.shtml</strong></a></p><p>A resource for introductory information on the Human Genome Project.</p><p><a href="http://His.se/bioinformatics"><strong>His.se/bioinformatics</strong></a></p><p>A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.</p><p><a href="http://Members.tripod.com/C.elegans/"><strong>Members.tripod.com/C.elegans/</strong></a></p><p>Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.</p><p><a href="http://Bioinformatics.org/faq/#contents"><strong>Bioinformatics.org/faq/#contents</strong></a></p><p>Summary of basics of bioinformatics for the intelligent newcomer.</p><p><a href="http://Jiscmail.ac.uk/archives/bioinformatics.html"><strong>Jiscmail.ac.uk/archives/bioinformatics.html</strong></a></p><p>Forum featuring various aspects, events and developments in the bioinformatics field.</p><p><a href="http://Biinoida.blogspot.com"><strong>Biinoida.blogspot.com</strong></a></p><p>Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.</p><p><a href="http://Colorbasepair.com/bioinformatics_courses_tutorials.html"><strong>Colorbasepair.com/bioinformatics_courses_tutorials.html</strong></a></p><p>A list of on-line course materials and tutorials for bioinformatics and computational biology.</p><p><a href="http://Geospiza.com/education/"><strong>Geospiza.com/education/</strong></a></p><p>Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.</p><p><a href="http://Bioinformatics.fi"><strong>Bioinformatics.fi</strong></a></p><p>An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.</p><p><a href="http://Perlsource.net"><strong>Perlsource.net</strong></a></p><p>Provides online courses in Perl programming for bioinformatic tools.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</guid>
	<pubDate>Mon, 10 Feb 2014 05:57:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</link>
	<title><![CDATA[List of generic simulation software/tools/resource with brief description and homepage !!!]]></title>
	<description><![CDATA[<p>List of generic simulation software/tools/resource with brief description and homepage</p><p><img src="http://www.evolution-of-life.com/fileadmin/images/carousel/genetic.PNG" alt="image" style="border: 0px;"></p><p>ALF <br />A Simulation Framework for Genome Evolution <br />http://www.cbrg.ethz.ch/alf<br /><br />Bayesian Serial SimCoal <br />Bayesian Serial SimCoal, (BayeSSC) is a modification of SIMCOAL 1.0, a program written by Laurent Excoffier, John Novembre, and Stefan Schneider. <br />http://www.stanford.edu/group/hadlylab/ssc/index.html<br /><br />BEERS <br />BEERS was designed to benchmark RNA-Seq alignment algorithms and also algorithms that aim to reconstruct different isoforms and alternate splicing from RNA-Seq data <br />http://cbil.upenn.edu/beers/<br /><br />BOTTLENECK <br />Bottleneck is a program for detecting recent effective population size reductions from allele data frequencies <br />http://www.ensam.inra.fr/urlb/bottleneck/bottleneck.html<br /><br />BottleSim <br />BottleSim is a computer simulation program for simulating the process of population bottlenecks <br />http://chkuo.name/software/bottlesim.html<br /><br />CASS <br />Protein Sequence Simulation <br />http://www.wyomingbioinformatics.org/liberlesgroup/cass/<br /><br />CDPOP <br />CDPOP is a landscape genetics tool for simulating the emergence of spatial genetic structure in populations resulting from specified landscape processes governing organism movement behavior. <br />http://cel.dbs.umt.edu/cdpop<br /><br />CoalFace <br />CoalFace is a simulation of the coalescent process with the visual display of gene genealogies. <br />http://web.up.ac.za/default.asp?ipkcategoryid=3283<br /><br />CoaSim <br />CoaSim is a tool for simulating the coalescent process with recombination and geneconversion under various demographic models. <br />http://users-birc.au.dk/mailund/coasim/index.html<br /><br />cosi <br />The cosi package is written in C and is available as a tar file. <br />http://www.broadinstitute.org/~sfs/cosi/<br /><br />CS-PSeq-Gen <br />A program to simulate the evolution of protein sequences under the constraints of the information of a particular reconstructed phylogeny <br />http://bioserv.rpbs.univ-paris-diderot.fr/software/cs-pseq-gen.html<br /><br />DAWG <br />An application designed to simulate the evolution of recombinant DNA sequences in continuous time <br />http://scit.us/projects/dawg<br /><br />Easypop <br />EASYPOP is an individual based model intended to simulate datasets under a very broad range of conditions <br />http://www.unil.ch/dee/page36926_fr.html<br /><br />EggLib <br />EggLib is a C++/Python library and program package for evolutionary genetics and genomics. <br />http://egglib.sourceforge.net/<br /><br />EvolSimulator <br />A simulation test bed for hypotheses of genome evolution <br />http://acb.qfab.org/acb/evolsim/<br /><br />EvolveAGene <br />A realistic coding sequence simulation program that separates mutation from selection and allows the user to set selection conditions <br />http://bellinghamresearchinstitute.com/software/index.html<br /><br />fastsimcoal <br />A continuous-&not;‐time coalescent simulator of genomic diversity under arbitrarily complex evolutionary scenarios <br />http://cmpg.unibe.ch/software/fastsimcoal/<br /><br />FastSLINK <br />Simulation of Marker and Phenotype Data in Pedigrees <br />http://watson.hgen.pitt.edu/<br /><br />FFPopSim <br />C++/Python library for population genetics. <br />http://webdav.tuebingen.mpg.de/ffpopsim/<br /><br />FLUX SIMULATOR <br />The Flux Simulator aims at providing a deterministic in silico reproduction of the experimental pipelines for RNA-Seq, employing a minimal set of parameters. <br />http://flux.sammeth.net/simulator.html<br /><br />ForSim <br />ForSim: A Forward Evolutionary Computer Simulation <br />http://www.anthro.psu.edu/weiss_lab/research.shtml<br /><br />ForwSim <br />The program given below is based on the algorithm described in Padhukasahasram et al. 2008 to simulate genetic drift in a standard Wright-Fisher process. <br />http://badri-populationgeneticsimulators.blogspot.com/<br /><br />FPG <br />Forward Population Genetic simulation <br />http://genfaculty.rutgers.edu/hey/software#fpg<br /><br />FREGENE <br />FREGENE is a C++ program that simulates sequence-like data over large genomic regions in large diploid populations. <br />http://www.ebi.ac.uk/projects/bargen/download/fregen/documentation_html.html<br /><br />GAMETES <br />Genetic Architecture Model Emulator for Testing and Evaluating Software: Simulates complex SNP models with pure, strict epistatic interactions with n-loci. <br />http://sourceforge.net/projects/gametes/?source=navbar<br /><br />GASP <br />Genometric Analysis Simulation Program. A software tool for testing and investigating methods in statistical genetics by generating samples of family data based on user specified models. <br />http://research.nhgri.nih.gov/gasp/<br /><br />GemSIM <br />Next generation sequencing read simulator <br />http://sourceforge.net/projects/gemsim/<br /><br />GeneArtisan <br />Simulation of Markers in Case-Control Study Designs <br />http://www.rannala.org/?page_id=241<br /><br />GENOME <br />A rapid coalescent-based whole genome simulator <br />http://www.sph.umich.edu/csg/liang/genome/<br /><br />GenomePop2 <br />GenomePop2 is a specialization of the program GenomePop just to manage SNPs under more flexible and useful settings. If you need models with more than 2 alleles please use the GenomePop program version. <br />http://webs.uvigo.es/acraaj/genomepop2.htm<br /><br />GenomeSimla <br />GenomeSIMLA is currently under development- however, we have a beta release that we are asking to be tested <br />http://chgr.mc.vanderbilt.edu/genomesimla/<br /><br />GENS2 <br />Simulates interactions among two genetic and one environmental factor and also allows for epistatic interactions. <br />https://sourceforge.net/projects/gensim/<br /><br />GWAsimulator <br />A rapid whole genome simulation program <br />http://biostat.mc.vanderbilt.edu/wiki/main/gwasimulator<br /><br />HAP-SAMPLE <br />An association simulator for candidate regions or genome scans <br />http://www.hapsample.org/<br /><br />HAPGEN <br />A simulator for the simulation of case control datasets at SNP markers <br />https://mathgen.stats.ox.ac.uk/genetics_software/hapgen/hapgen2.html<br /><br />HapSim <br />A simulation tool for generating haplotype data with pre-specified allele frequencies and LD coefficients <br />http://cran.r-project.org/web/packages/hapsim/index.html<br /><br />HAPSIMU <br />A program that simulates heterogeneous populations with various known and controllable structures under the continuous migration model or the discrete model <br />http://l.web.umkc.edu/liujian/<br /><br />IBDsim <br />IBDSim is a computer package for the simulation of genotypic data under general isolation by distance models. <br />http://raphael.leblois.free.fr/<br /><br />indel-Seq-Gen <br />A biological sequence simulation program that simulates highly divergent DNA sequences and protein superfamilies <br />http://bioinfolab.unl.edu/~cstrope/isg/<br /><br />Indelible <br />A powerful and flexible simulator of biological evolution <br />http://abacus.gene.ucl.ac.uk/software/indelible/<br /><br />invertFREGENE <br />InvertFREGENE is a forward-in-time simulator of inversions in population genetic data <br />http://www.ebi.ac.uk/projects/bargen/<br /><br />kernalPop <br />A spatially explicit population genetic simulation engine <br />http://cran.r-project.org/src/contrib/archive/kernelpop/<br /><br />MaCS <br />Markovian Coalescent Simulator <br />http://www-hsc.usc.edu/~garykche/<br /><br />Mason <br />A package for the simulation of nucleotide data. <br />http://www.seqan.de/projects/mason/<br /><br />mbs <br />modifying Hudson's ms software to generate samples of DNA sequences with a biallelic site under selection <br />http://www.sendou.soken.ac.jp/esb/innan/innanlab/software.html<br /><br />Mendel's Accountant <br />Mendel's Accountant (MENDEL) is an advanced numerical simulation program for modeling genetic change over time and was developed collaboratively by Sanford, Baumgardner, Brewer, Gibson and ReMine <br />http://mendelsaccount.sourceforge.net/<br /><br />MetaSim <br />A tool to generate collections of synthetic reads that reflect the diverse taxonomical composition of typical metagenome data sets <br />http://ab.inf.uni-tuebingen.de/software/metasim/<br /><br />mlcoalsim <br />Multilocus Coalescent Simulations <br />http://code.google.com/p/mlcoalsim-v1/<br /><br />ms <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/source/mksamples.html<br /><br />msHOT <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/<br /><br />msms <br />A coalescent Simlation tool with selection. <br />http://www.mabs.at/ewing/msms/index.shtml<br /><br />MySSP <br />A program for the simulation of DNA sequence evolution across a phylogenetic tree <br />http://www.rosenberglab.net/software.php<br /><br />Nemo <br />A forward-time, individual-based, genetically explicit, and stochastic simulation program designed to study the evolution of genetic markers, life history traits, and phenotypic traits in a flexible (meta-)population framework. <br />http://nemo2.sourceforge.net/<br /><br />NetRecodon <br />Coalescent simulation of coding DNA sequences with recombination (inter and intracodon), migration and demography <br />http://code.google.com/p/netrecodon/<br /><br />PEDAGOG <br />Software for simulating eco-evolutionary population dynamics <br />https://bcrc.bio.umass.edu/pedigreesoftware/node/5<br /><br />phenosim <br />A tool to add phenotypes to simulated genotypes <br />http://evoplant.uni-hohenheim.de/doku.php?id=software:software<br /><br />PhyloSim <br />An R package for the Monte Carlo simulation of sequence evolution <br />http://bit.ly/rlsim-git<br /><br />pIRS <br />Profile-based Illumina pair-end reads simulator <br />https://code.google.com/p/pirs/<br /><br />ProteinEvolver <br />Simulation of protein evolution along phylogenies under structure-based substitution models <br />http://code.google.com/p/proteinevolver/<br /><br />QMSim <br />QTL and Marker Simulator <br />http://www.aps.uoguelph.ca/~msargol/qmsim/<br /><br />quantiNEMO <br />An individual-based program for the analysis of quantitative traits with explicit genetic architecture potentially under selection in a structured population <br />http://www2.unil.ch/popgen/softwares/quantinemo/<br /><br />RECOAL <br />Simulates new haplotype data from a reference population of haplotypes. <br />ftp://popgen.usc.edu/<br /><br />Recodon <br />Coalescent simulation of coding DNA sequences with recombination, migration and demography <br />http://code.google.com/p/recodon/<br /><br />rlsim <br />A package for simulating RNA-seq library preparation with parameter estimation <br />http://bit.ly/rlsim-git<br /><br />Rmetasim <br />Rmetasim is a front-end for the metasim engine that is implemented as a package that runs in the statistical computing environment R <br />http://linum.cofc.edu/software.html#metasim<br /><br />RNA Seq Simulator <br />RSS takes SAM alignment files from RNA-Seq data and simulates over dispersed, multiple replica, differential, non-stranded RNA-Seq datasets. <br />http://useq.sourceforge.net/cmdlnmenus.html#rnaseqsimulator<br /><br />Rose <br />Random model of sequence evolution <br />http://bibiserv.techfak.uni-bielefeld.de/rose/<br /><br />SelSim <br />SelSim is a program for Monte Carlo simulation of DNA polymorphism data for a recom- bining region within which a single bi-allelic site has experienced natural selection <br />http://www.well.ox.ac.uk/~spencer/selsim/<br /><br />Seq-Gen <br />An application for the Monte Carlo simulation of molecular sequence evolution along phylogenetic trees. <br />http://tree.bio.ed.ac.uk/software/seqgen/<br /><br />SEQPower <br />Statistical power analysis for sequence-based association studies <br />http://bioinformatics.org/spower/<br /><br />SeqSIMLA <br />SeqSIMLA can simulate sequence data with user-specified disease and quantitative trait models. Family or unrelated case-control data can be simulated. <br />http://seqsimla.sourceforge.net/<br /><br />Serial NetEvolve <br />A flexible utility for generating serially-sampled sequences along a tree or recombinant network <br />http://biorg.cis.fiu.edu/sne/<br /><br />SFS_CODE <br />SFS_CODE can perform forward population genetic simulations under a general Wright-Fisher model with arbitrary migration, demographic, selective, and mutational effects. <br />http://sfscode.sourceforge.net/sfs_code/index/index.html<br /><br />SIBSIM <br />Quantitative phenotype simulation in extended pedigrees <br />http://sourceforge.net/projects/sibsim/<br /><br />SIMCOAL2 <br />A coalescent program for the simulation of complex recombination patterns over large genomic regions under various demographic models <br />http://cmpg.unibe.ch/software/simcoal2/<br /><br />SimCopy <br />An R package simulating the evolution of copy number profiles along a tree. <br />http://bit.ly/simcopy<br /><br />SIMLA <br />SIMLA is a SIMuLAtion program that generates data sets of families for use in Linkage and Association studies. <br />http://www.chg.duke.edu/research/simla.html<br /><br />SimPed <br />A Simulation Program to Generate Haplotype and Genotype Data for Pedigree Structures <br />http://www.hgsc.bcm.tmc.edu/content/simped<br /><br />Simprot <br />A program to simulate protein evolution by substitution, insertion and deletion <br />http://www.uhnresearch.ca/labs/tillier/software.htm#3<br /><br />SimRare <br />Rare variant simulation and analysis tool <br />http://code.google.com/p/simrare/<br /><br />simuGWAS <br />A forward-time simulator that simulates realistic samples for genome-wide association studies. <br />http://simupop.sourceforge.net/cookbook/simucomplexdisease<br /><br />simuPOP <br />simuPOP is a general-purpose individual-based forward-time population genetics simulation environment. <br />http://simupop.sourceforge.net/<br /><br />SISSI <br />A software tool to generate data of related sequences along a given phylogeny, taking into account user defined system of neighbourhoods and instantaneous rate matrices. <br />http://www.cibiv.at/software/sissi/<br /><br />SNPsim <br />Coalescent simulation of hotspot recombination <br />http://code.google.com/p/phylosoftware/<br /><br />SPIP <br />SPIP simulates the transmission of genes from parents to offspring in a population having demographic structure defined by the user <br />http://swfsc.noaa.gov/textblock.aspx?division=fed&amp;id=3434<br /><br />Splatche <br />Spatial and Temporal Coalescences in Heterogeneous Environment <br />http://www.splatche.com/<br /><br />srv <br />Simulator of Rare Varaints (srv) is a simulator for the simulation of the introduction and evolution of (rare) genetic variants. <br />http://simupop.sourceforge.net/cookbook/simurarevariants<br /><br />SUP <br />SLINK/FastSLINK utility program <br />http://mlemire.freeshell.org/software.html<br /><br />TreesimJ <br />A flexible, forward-time population genetic simulator <br />http://code.google.com/p/treesimj/<br /><br />Vortex <br />VORTEX is an individual-based simulation model for population viability analysis (PVA). <br />http://www.vortex9.org/vortex.html<br /><br />References:</p><p>Image www.evolution-of-life.com</p><p>www.cancer.gov</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</guid>
	<pubDate>Sun, 16 Dec 2018 13:04:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38472/gpsrdocker-docker-based-container-that-contain-all-softwareweb-servers-developed-in-the-field-of-bioinformatics</link>
	<title><![CDATA[gpsrdocker: docker-based container that contain all software/web servers developed in the field of bioinformatics.]]></title>
	<description><![CDATA[<p><span>GPSRdocker (</span><a href="http://webs.iiitd.edu.in/gpsrdocker/">http://webs.iiitd.edu.in/gpsrdocker/</a><span>) is&nbsp; Presently it contain software developed at G. P. S. Raghava's group (</span><a href="http://webs.iiitd.edu.in/raghava/">http://webs.iiitd.edu.in/raghava/</a><span>&nbsp;). </span></p>
<p><span>The programs and the package are free software for academic users. Permission to use, copy, and modify any part of this software for educational, research and non-profit purposes is hereby granted. In this package or Docker image, number of other supported software has been integrated which may be under other licenses, along with any direct or indirect dependencies of the primary software being contained. As for any pre-built image usage, it is the image user's responsibility to ensure that any use of this image complies with any relevant licenses for all software contained within. </span></p>
<p><span>All software packages are distributed in the hope that they will be useful but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. If you have any query, please contact at raghava@iiitd.ac.in.</span></p><p>Address of the bookmark: <a href="https://hub.docker.com/r/raghavagps/gpsrdocker/" rel="nofollow">https://hub.docker.com/r/raghavagps/gpsrdocker/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39472/louisiana-biomedical-research-network-summer-bioinformatics-training-program</guid>
	<pubDate>Wed, 05 Jun 2019 15:30:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39472/louisiana-biomedical-research-network-summer-bioinformatics-training-program</link>
	<title><![CDATA[Louisiana Biomedical Research Network: Summer Bioinformatics Training Program]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/06/LBRN-Summer-Program1-CCT.jpg" alt="2019 summer bioinformatics training program" width="600" height="337.5" style="border: 0px;"></p><p>Louisiana Biomedical Research Network (LBRN) announces registration for it's Summer 2019 Bioinformatics Training Program. The program will be focused on processing, analysis and interpretation of next generation sequecning data for biologists. Learn more:</p><p>https://edu.t-bio.info/louisiana-biomedical-research-network-summer-2019-lbrn-bioinformatics-training-program/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</guid>
	<pubDate>Thu, 10 Oct 2019 22:12:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</link>
	<title><![CDATA[Naegleria fowleri: brain eating amoebae]]></title>
	<description><![CDATA[<div><em>Naegleria fowleri</em>&nbsp;is a free living, universally distributed amoeba, which is mostly found in natural, stagnant, warm water bodies such as ponds, lakes, etc. It is also reported to be present even in indoor water bodies, such as swimming pools within a temperature range of 40&ndash;45&deg;C.&nbsp;</div><div>&nbsp;</div><div><img src="https://d.newsweek.com/en/full/351971/naegleria-fowleri.jpg" alt="image" width="720" height="634" style="border: 0px; border: 0px;">&nbsp;</div><div><em style="font-size: 12.8px;">N. fowleri</em>&nbsp;infects the central nervous system of human body by entering through the nose during swimming and outdoor baths in natural stagnant water bodies, leading to meningoencephalitis. It is a condition of inflammation of cerebral tissues and membranes of the brain and is mostly fatal in nature. Casualties due to N. fowleri infections are reported all across the globe including a few in India but only seven survivors in the entire world have been reported till 2015.</div><div>&nbsp;</div><div>You can find two genome assembly at&nbsp;</div><div><a href="https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri">https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri</a></div><div>&nbsp;</div><div>More at&nbsp;<a href="https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri">https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri</a></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40957/multiple-phd-positions</guid>
  <pubDate>Sun, 09 Feb 2020 03:10:28 -0600</pubDate>
  <link></link>
  <title><![CDATA[Multiple PhD positions]]></title>
  <description><![CDATA[
<p>14 PhD positions in the EU Horizon 2020 Marie Skłodowska-Curie Project PRECODE:<br />International training network which sets a joint research programme to train a new generation of leading scientists in model systems and methods for the development of new therapies for pancreatic cancer (PaCa)</p>

<p>http://precode-project.eu/jobs-board/#1572451761376-39d75f63-c6fb</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42166/software-for-genome-assembly</guid>
	<pubDate>Sun, 30 Aug 2020 09:51:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42166/software-for-genome-assembly</link>
	<title><![CDATA[Software for genome assembly !]]></title>
	<description><![CDATA[<p>List of bioinformatics tools/Software Website References for genome assembly:</p><p>1 Falcon&nbsp;https://github.com/PacificBiosciences/pb-assembly</p><p>2 Canu assembler http://canu.readthedocs.io/en/latest/index.html</p><p>3 Miniasm assembler https://github.com/lh3/miniasm</p><p>4 PBJelly scaffolding tool https://sourceforge.net/projects/pb-jelly/</p><p>5 ARCS scaffolding tool https://github.com/bcgsc/arcs</p><p>6 Redundans reduction and scaffolding tool https://github.com/Gabaldonlab/redundans</p><p>7 Arrow error correction https://github.com/PacificBiosciences/ GenomicConsensus</p><p>8 PILON error correction https://github.com/broadinstitute/pilon/wiki</p><p>9 BUSCO single copy gene markers http://busco.ezlab.org/</p><p>10 Bandage graph assembly viewer https://rrwick.github.io/Bandage/</p><p>11 Gepard dotter http://cube.univie.ac.at/gepard</p><p>12 MUMmer aligner and plotter http://mummer.sourceforge.net/</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43256/senior-scientist-bioinformatics-eurofins-genomics-india-pvt-ltd-bengaluru</guid>
  <pubDate>Sat, 14 Aug 2021 13:17:36 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Scientist bioinformatics @ Eurofins Genomics India Pvt Ltd, Bengaluru.]]></title>
  <description><![CDATA[
<p>Eurofins hiring @ Eurofins Genomics India Pvt Ltd, Bengaluru.</p>

<p>Designation: Senior Scientist bioinformatics<br />Experience: 8-9 years of experience in bioinformatics analysis of various NGS applications such as WGS, RNASeq, Metagenome, small RNA.</p>

<p>Location: Bangalore</p>

<p>Roles &amp; Responsibilities:<br />-Develop NGS pipeline for analysis and interpretation of NGS data<br />-Organizing and managing large scale genomic data<br />-Should have experience in NGS data analysis, such as WGS, RNASeq, Small RNA, Metagenome (16S, ITS, Whole metagenome)etc.<br />-Should also have good programming skills in perl or python, PHP,J Query, MySql.<br />-Manage project timelines and deliverables.<br />-Implement and execute data processing workflows and automate the pipelines.</p>

<p>If you are interested, please send your profile to me at arpitaghosh@eurofins.com with “Senior Scientist bioinformatics for Genomics” as the subject.</p>
]]></description>
</item>

</channel>
</rss>