BOL: Related items

Rosalind Problem Solution with Perl

Jit — Tue, 09 Jun 2015 23:35:18 -0500

Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works.

Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...

Pattern Matching Problem Solution with Perl

Jit — Tue, 09 Jun 2015 23:58:45 -0500

Problem at http://rosalind.info/problems/1c/

#Find all occurrences of a pattern in a string.
#Given: Strings Pattern and Genome.
#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.

use strict;
use warnings;

my $string="GATATATGCATATACTT";
my $subStr="ATAT";
my $kmer=length($subStr);

kmerMatch ($string, $subStr, $kmer);

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
for (my $aa=0; $aa<=(length($string)-$kmer); $aa++) {
    my $myWin=substr $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        print $aa;
    }
}
}

Bioinformatics Scripts

Jit — Thu, 22 Jan 2015 22:29:39 -0600

Some of the useful bioinformatics scripts.

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Reverse Complement Problem Solved with Perl

Jit — Tue, 09 Jun 2015 23:37:23 -0500

Question at http://rosalind.info/problems/1b/

#Find the reverse complement of a DNA string.
#Given: A DNA string Pattern.
#Return: Pattern, the reverse complement of Pattern.

use strict;
use warnings;

my $string="AAAACCCGGT";
my $finalString="";
my %hash = (
   "C" => "G",
   "A" => "T",
   "T" => "A",
   "G" => "C",
);

for (my $aa=0; $aa<=(length($string)-1); $aa++) {
   my $char=substr $string, $aa, 1;
   #print $hash{$char};
   $finalString="$hash{$char}"."$finalString";
}

print $finalString;
print "\n";

Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud

Rahul Nayak — Thu, 20 Aug 2015 02:21:20 -0500

InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines.

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Which of the followings are the best place to study Bioinformatics ?

Reshma Khatun — Sun, 28 Dec 2014 00:20:30 -0600

Bioinformatics is a major growth area and qualified Bioinformaticians are in high demand. An explosion in biological data has resulted from genome projects, next generation sequencing and other 'omics' techniques. Bioinformatics provides the tools to analyse and exploit such data sets.

Can you please suggest me the best place to study bioinformatics ( Grad/PostGrad).

Type Hinting

Pranjali Yadav — Fri, 09 Jan 2015 22:26:13 -0600

Python creator Guido van Rossum’s proposal for static type-checking annotations is inching closer to reality, and the feature has taken on a new name: type hinting.

Back in August, van Rossum published a proposal on the Python mailing list recommending type-checking annotations as a valuable feature for the next version of Python to improve the performance of editors and IDEs, linter capabilities, standard notation, and refactoring. Van Rossum’s latest proposal, posted late last month, outlined plans to publish a Python Enhancement Proposal (PEP) in early January to put the feature now known as type hinting on track for inclusion in Python 3.5, slated for release this September.

Reference

https://quip.com/r69HA9GhGa7J