1. TATA SCHOLARSHIP - Cornell University, New York State, USA
Tata, the Indian multinational conglomerate company, have a foundation known as the Tata Education & Development Trust which has endowed a multi million dollar sum to Cornell University to provide undergraduate scholarships to 20 Indian students every year.  In another example of supporting American universities, the Tata group also pledged US$50 million to Harvard University in recent years, whose executive management programme Ratan Tata attended in the 1970s.  Read more...  

2. BRADMAN FOUNDATION SCHOLARSHIP - University of Wollongong, Australia.
Named after Australia's cricket legend Donald Bradman, the UOW Bradman Foundation Scholarship was launched in 2012, with the help of Adam Gilchrist no less, to offer one successful Indian student each year a 50% reduction in tuition fees.  Read more...  

3. HUAWEI MAITREE SCHOLARSHIPS - Various Universities, China
Along with Tata, Huawei are the other huge corporation to be featured.  China's massive telecoms equipment vendor are involved in these scholarships offered to Indian students studying in China.  In 2013 there are 10 generous scholarships available which provide full tuition fees and living expenses.  The courses on which the scholarships are offered include Science and Technology courses, Social Sciences and Culture and Development courses.  Read more...

4. DR. MANMOHAN SINGH SCHOLARSHIPS - Cambridge University, England, UK
These scholarships have been designed to help budding Indian minds follow in the footsteps of Indian prime minister Manmohan Singh by studying at the prestigious Cambridge University.  The scholarships can be applied to any undergarduate course (with the two exceptions of medicine and veterinary science) and cover everything, i.e. tuition and college fees, living expenses and an additional grant to go towards travel expenses.  Read more...

5. OXFORD AND CAMBRIDGE SOCIETY OF INDIA - Oxford & Cambridge Universities, England, UK
As the name might suggest, these are scholarships available for students wishing to study at Oxford or Cambridge (cleverly known together as Oxbridge).  It is only available for applicants who are completing or have completed a degree at an Indian university, however these scholarships are for both undergraduate and graduate students.  Read more...

6. EDINBURGH NAPIER UNIVERSITY - Scotland, UK
This one applies to all countries in the Indian subcontinent and is for both undergraduate and graduate courses. Edinburgh Napier University offers a merit based discount of £2,000 Pounds.  Read more...

7. SHEFFIELD UNIVERSITY - Sheffield, UK
Provides merit-based scholarships for undergraduate and graduate programmes across all subjects. Read more...

8. INDIA 4EU II - Several Universities across Europe
Pioneered by the European Union and involving partner universities in France, Finland, Germany, Italy, Portugal, Spain and Sweden, the India 4EU II initiative is aimed at encouraging Indian students to study, work and live in Europe.  The initiative is well funded and allows the successful students tuition fees, expenses for living and travel costs as well as insurance during their time at one of the partner universities.  Read more...

9. TRINITY COLLEGE DUBLIN - Ireland
Valid for undergraduate courses in the faculties of Arts, Humanities, Social Sciences, Science, Computer Science or Engineering, the Trinity College Dublin offers Indian students scholarships to the tune of €9,000 per annum over a year degree course.  Read more...

10. UNIVERSITY COLLEGE DUBLIN - Ireland
Another of Ireland and Dublin's finest, the UCD awards one Global Excellence Undergraduate Scholarship which provides the worthy student a substantial 50% towards their tuition fees and is valid for all courses save medicine, radiography and veterinary medicine.  UCD also offers a Global Undergraduate Scholarship scheme for undergrads accepted on science, social sciences, arts and business courses.  This is all thanks to a €250,000 fund that will allow for 57 Indian students to benefit from scholarships at UCD.  Read more...

Developing Solutions Masters Scholarship at University of Nottingham, UK
Scholarship Provider: University of Nottingham
Eligible Students: Applicants are not currently studying at a University of Nottingham campus or are not a University of Nottingham graduate.
Courses: Scholarships are available for pursuing masters degree programme at University of Nottingham.
Award Details: 105 scholarships are available as follows: 30 x 100% tuition fee and 75 x 50% of tuition fees.
Application Deadline: 22 April 2016

Julius Nyerere Master’s Scholarships for Tanzanian Students at University of Edinburgh, UK
Scholarship Provider: University of Edinburgh, UK
Eligible Students: Applicants should already have been offered a place at the University of Edinburgh and should have firmly accepted that offer or be intending to do so.
Courses: Scholarship is available for pursuing master’s degree at University of Edinburgh.
Award Details: The Julius Nyerere Master’s Scholarships will cover the full overseas tuition fee, living costs of £10,000, and a return flight from Tanzania to the UK.
Application Deadline: 1st April 2016

Commonwealth Shared Scholarships in UK, 2016
Scholarship Provider: Commonwealth Scholarship Commission in the United Kingdom (CSC) in partnership with UK universities.
Eligible Students: Applicant must be a Commonwealth citizen, refugee, or British protected person.
Courses: Scholarships are available for pursuing masters degree program at UK Institutions.
Award Details: Each Scholarship provides study travel grant towards the costs of study-related travel within the UK or overseas
Application Deadline: April 1, 2016

World Citizen Talent Scholarships for Non-EEA Students
Scholarship Provider: Hague University, Netherlands
Eligible Students: Applicant must enrolling for the first time and have not studied at any programmes of The Hague University of Applied Sciences
Courses: Scholarships are available for pursuing bachelor degree level at Hague University.
Award Details: Scholarships each worth EUR 5,000 are available to prospective bachelor degree students for the 2016-2017 academic year.
Application Deadline: 31 March 2016

IHRP Emerging Scholar Program at Mahidol University
Scholarship Provider: The Institute of Human Rights and Peace Studies (IHRP), Mahidol University, Thailand
Eligible Students: Applicant should have very strong English skills.
Courses: Scholarship is available for pursuing MA degree programme.
Award Details: The scholarship allows for reduced tuition and thesis fees (4,200 Baht per credit to 1,200 Baht per credit each term and a 50 % of the cost of the thesis fee).
Application Deadline: March 31, 2016

2016 FIG Foundation PhD Scholarships for Developing Countries, Denmark
Scholarship Provider: FIG Foundation
Eligible Students: Applicants from low-income, lower-middle or upper-middle income economy are eligible.
Courses: Scholarships are available for pursuing PhD programme.
Award Details: Successful applicants will qualify for a further grant of up to 3,000 euros to attend and present a peer reviewed paper at a FIG conference. 
Application Deadline: The application deadline is 1 March 2016.

International Climate Protection Fellowships for Developing Countries
Scholarship Provider: Federal Environment Ministry’s (BMU) International Climate Initiative
Eligible Students: Applicant should have very good knowledge of English or German
Courses: Fellowships are available for undertaking research in Germany
Award Details: Fellowship amount according to qualifications between €2,150 and €2,650 per month
Application Deadline: 1 March 2016

International Space University Scholarship Program in France, 2016
Scholarship Provider: The International Space University
Eligible Students: This financial aid is available for applicants from Europe, the United States, Canada and Australia, developing countries and from other countries.
Courses: Scholarship is available for MSS, SSP and SH-SSP students.
Award Details: This aid is available to selected applicants, and covers a portion of their tuition fees.
Application Deadline: MSS applicants: 15 March 2016, SSP16 applicants: 30 April 2016 and SH-SSP16 applicants: 30 November

Janssen Pharmaceutica Scholarships for MSc in UK, 2016-2017
Scholarship Provider: London School of Hygiene and Tropical Medicine, UK
Eligible Students: Applicants must hold an offer of admission to the MSc Global Mental Health commencing in 2016-17.
Courses: Scholarships are available for pursuing masters degree at King’s College London.
Award Details: Each scholarship will cover full tuition fees, a living expense stipend of GBP 15,298.00 and an allowance in the summer for project expenses.
Application Deadline: 29 February 2016

Reach Oxford Scholarship for Students from Developing Countries
Scholarship Provider: Oxford University, UK
Eligible Students: This scheme is only suitable for candidates of the highest academic ability who have outstanding examination results.
Courses: Scholarships are available for pursuing undergraduate degree level at Oxford University.
Award Details: Scholarship covers University fees and college fees, a grant for living expenses and one return air fare per year.
Application Deadline: 17 February 2016

Jay Jordan IFLA/OCLC Development Fellowship Program, 2017
Scholarship Provider: International Federation of Library Associations and Institutions (IFLA) and OCLC
Eligible Students: Applicant must have a qualifying degree in library or information science.
Courses: This is a intensive four-week Fellowship program based at OCLC’s headquarters in Dublin, Ohio, USA for library and information science professionals.
Award Details: The award provides each fellow Airfare, coach class, from the recipient’s home country to the United States and return trip to the recipient’s home country
Application Deadline: February 12, 2016

Franklin Mosher Baldwin Memorial Fellowships for Developing Countries, 2016
Scholarship Provider: The Leakey Foundation
Eligible Students: Citizens of a developing countries are eligible.
Courses: Fellowships are available for advanced special training or studies leading towards an M.A or PhD.
Award Details: The maximum award is limited to $15,000 per year.
Application Deadline: The application deadline is February 15 2016.

MIDS-Managed Scholarships for Developing Countries
Scholarship Provider: Geneva Law School and Graduate Institute of International and Development Studies
Eligible Students: Demonstrated financial need on the part of candidates as well as their immediate and extended families, employers and any other persons who might otherwise have been able to contribute toward financing their MIDS studies.
Courses: This scholarship is available for pursuing Master’s degree (LLM).
Award Details: These scholarships cover the total tuition fees as well as CHF 15,000 toward living expenses.
Application Deadline: 1 February 2016

IMMANA Postdoctoral Fellowships, 2016
Scholarship Provider: UK Department for International Development (DFID), UK government
Eligible Students: Eligible applicants will have completed a doctorate (PhD, DPhil, DPH, MD, DVM or similar terminal degree) in any field
Courses: Fellowships are available for undertaking postdoctoral research programme.
Award Details: A fixed stipend of £34,000 (approximately $52,000) paid in quarterly installments against satisfactory completion of programme milestones.
Application Deadline: 1 February 2016

2016 EDCTP-TDR Clinical Research and Development Fellowships
Scholarship Provider: European & Developing Countries Clinical Trials Partnership (EDCTP) and WHO/TDR.
Eligible Students: Applicant must be a post-graduate (MSc or PhD) or medical graduate with clinical and/or research experience in infectious diseases.
Courses: Fellowships are available to early to mid-career clinical researchers and key members of clinical trial research teams.
Award Details: The grant covers one economy class return ticket (home – host organisation – home); a monthly stipend; health insurance; an allowance to cover essential educational support materials.
Application Deadline: 28 January 2016 (Stage 1) and 21 July 2016 (Stage 2: Training plan – EDCTP only).

United Nations/Japan Long-term Fellowship Programme on Nano-Satellite Technologies
Scholarship Provider: The United Nations Office for Outer Space Affairs and the Government of Japan
Eligible Students: Be nationals of developing countries or countries with economy in transition; be duly nominated by their institutions.
Courses: Scholarship is available for pursing PhD students.
Award Details: The selected candidates will each receive a grant under Japanese government (Mobukagakusho: MEXT) scholarship (Research Students) of about 145,000 yen per month.
Application Deadline: 24 January 2016

The Daniel Turnberg UK/Middle East Travel Fellowship Scheme
Scholarship Provider: Daniel Turnberg Memorial Fund with ongoing support from the Royal College of Physicians, London, the Wellcome Trust and the Wolfson Family Charitable Trust.
Eligible Students: Fellowship is open for medical and non-medical graduates who can show a commitment to a career in research.
Courses: Travel Fellowship for Medical researchers and bio scientists in the field of biomedical.
Award Details: The Fellowship will cover airfare and a subsistence allowance for a period of up tofour weeks. Funding is provided to an upper limit of £3,500 per fellowship
Application Deadline: 18 January 2016

MMMF Grants for Women of Developing Countries, 2016
Scholarship Provider: Margaret McNamara Memorial Fund
Eligible Students: Demonstrate a commitment to working to empower women and children in developing countries.
Courses: Grant is available towards the completion of the degree program in Canada and USA.
Award Details: An MMMF grant covers only a portion of the total costs for an academic year.
Application Deadline: January 16, 2016

Dorothy Marchus Senesh Fellowship for Women from Developing Countries in USA, 2016-2017
Scholarship Provider: International Peace Research Association Foundation
Eligible Students: The Dorothy Senesh Fellowships are available to women from developing countries.
Courses: Fellowships are available for pursuing graduate programme.
Award Details: The Fellowships provide $5,000 per year for two years for both women, for a total of $10,000 each.
Application Deadline: Applications are due by January 15, 2016.

Dorothy Marchus Senesh Fellowship for Women, 2016-2017
Scholarship Provider: International Peace Research Association Foundation
Eligible Students: The Dorothy Senesh Fellowships are available to women from developing countries who have completed a Bachelor’s degree
Courses: Fellowships are available for pursuing graduate programme.
Award Details: The Fellowships provide $5,000 per year for two years for both women, for a total of $10,000 each.
Application Deadline: January 15, 2016

Louis Dreyfus-Weidenfeld Scholarship in UK, 2016
Scholarship Provider: Louis Dreyfus Foundation and University of Oxford, UK
Eligible Students: This scholarship seeks to support individuals who, following completion of their supported studies, will go on to actively engage in the chosen fields.
Courses: Scholarships are available for pursuing full time graduate degree at University of Oxford.
Award Details: The scholarship will cover 100% of University and college fees and a grant for living costs (of at least £14,057).
Application Deadline: 8 or 22 January 2016, depending on your course.

WWF Prince Bernhard Scholarships for Developing Countries
Scholarship Provider: WWF, Switzerland
Eligible Students: Applications are encouraged from people seeking to build skills in specific subjects that will enhance their contribution to nature conservation.
Courses: Scholarships are available for pursuing formal studies or professional training.
Award Details: The maximum amount for any one scholarship under this scheme is CHF 10,000 and preferential consideration is given to requests for less than CHF 10,000.
Application Deadline: 5 January 2016

JNCASR-CICS Fellowship Programme for Developing Countries in India, 2016
Scholarship Provider: Jawaharlal Nehru Centre for Advanced Scientific Research (JNCASR ) Bangalore and the Centre for International Co-operation in Science(CICS) Chennai, India
Eligible Students: Citizens of developing countries
Courses: Fellowships are available to undertake research studies (short-term, participatory research) in India.
Award Details: The Fellowship covers return airfare from place of work in their home country to place of work in India, boarding and lodging at the affiliated institution/s, and an adequate allowance in Indian currency to cover incidental expenses.
Application Deadline: The last date for receipt of the applications is 31st October every year.

IFS Individual Research Grants for Citizens of Developing Countries, 2016
Scholarship Provider: International Foundation for Science (IFS)
Eligible Students: Citizens of following developing countries.
Courses: Grants are available for pursuing research programme.
Award Details: Individual Research grants are awarded on merit in amounts up to USD 12,000 for one to three years.
Application Deadline: The deadline for submission of research grant applications is 31st December 2015.

IRO Doctoral Scholarship for Developing Countries Students in Belgium
Scholarship Provider: Catholic University of Leuven’s Interfaculty Council for Development Cooperation, Belgium
Eligible Students: The candidate must hold an academic qualification at least equivalent to a high distinction.
Courses: Scholarships are available for pursuing PhD program at KU Leuven
Award Details: The scholarship includes monthly basic amount € 1,415 (75% of the net salary of an assistant) paid at the end of each month for doctoral students and €1000 paid at the beginning of each month
Application Deadline: November 9th

Commonwealth Split-site (PhD) Scholarships for Developing Countries, 2016
Scholarship Provider: UK Department for International Development (DFID)
Eligible Students: Be registered for a PhD at a university in your home country
Courses: Scholarships are available for pursuing Split-site (PhD)
Award Details: Each scholarship provides study travel grant towards the costs of study-related travel within the UK or overseas
Application Deadline: 19 November

2016 Commonwealth Medical Fellowships in UK
Scholarship Provider: UK Department for International Development (DFID)
Eligible Students: Applicant must have qualified as a doctor or dentist between 1 October 2006 and 30 September 2009, or before 1 October 2001
Courses: Fellowships are available to doctors and dentists to enable them to spend between three and six months at a UK hospital.
Award Details: Each fellowship provides research support grant, payable to your host university hospital
Application Deadline: 19 November

Commonwealth Academic Fellowships for Mid-Career Academics in UK, 2016
Scholarship Provider: UK Department for International Development (DFID)
Eligible Students: Applicant must be permanently resident in a developing Commonwealth country
Courses: Fellowships are awarded for early career academics to spend three months undertaking research and updating their skills at any approved UK university or higher education institution.
Award Details: Each fellowship provides grant towards the cost of preparing reports and other written work
Application Deadline: 19 November

PROVIA Visiting Fellowship Programme
Scholarship Provider: The Global Programme of Research on Climate Change Vulnerability, Impacts and Adaptation (PROVIA) and START
Eligible Students: The fellowship is open to professionals and researchers whose work involves designing, implementing, or promoting adaptation solutions.
Courses: Fellowship is available for four weeks residential programme at the host institution.
Award Details: It provides travel (airfare, visa application fee, and airport transfer) and accommodation (housing, daily subsistence allowance) expenses for this fellowship will be covered.
Application Deadline: 20 November

Global Change Leaders Scholarship Program for Developing Countries
Scholarship Provider: The Coady International Institute, St. Francis Xavier University
Eligible Students: This program is targeted to emerging women leaders from developing countries who are working on development issues
Courses: It is a seven-week education program at Coady Institute’s International Centre for Women’s Leadership.
Award Details: The Global Change Leaders program provides successful candidates with a full scholarship that includes tuition, travel, accommodations, and meals.
Application Deadline: December 4

Center for Universal Education Echidna Global Program, 2016
Scholarship Provider: The Center for Universal Education, Brookings Institution, USA
Eligible Students: Applicants should have a background in education, development, economics, or a related area, with at least 15 years of professional experience
Courses: Scholarship is available for undertaking research at the Brookings Institution.
Award Details: Applicants selected for the fellowship will receive a living stipend of USD $5,000 a month (subject to U.S. tax withholding), paid housing for the four-and-a-half month term, and round-trip travel expenses.
Application Deadline: November 30

2016 IARC Postdoctoral Fellowships in Cancer Research, France
Scholarship Provider: The International Agency for Research on Cancer (IARC)
Eligible Students: Candidates are required to have finished their doctoral degree (Ph.D.) within five years of the closing date.
Courses: Fellowships are available for postdoctoral researchers to complete their training at the IARC in France.
Award Details: The annual stipend is currently 33 000 Euros and will be paid monthly in advance.
Application Deadline: 30 November

Islamic Development Bank Prize
Scholarship Provider: Islamic Development Bank
Eligible Students: Applicant must have engage in activities and /or reside in one of the IDB member countries or in a Muslim community in non-member countries.
Courses: Prize is available for women who have developed or be actively involved in projects/activities that are innovative and helped to improve access to safe and affordable water
Award Details: The Prize consists of two cash awards-U.S. $ 50,000 for a woman or a group of women and U.S. $ 100,000 for an organization.
Application Deadline: 30th November

Schlumberger Foundation Faculty for the Future Fellowships, 2016
Scholarship Provider: The Schlumberger Foundation
Eligible Students: Fellowship applicants should have a proven track record of teaching experience or can demonstrate commitment to teaching.
Courses: Fellowships are available to pursue PhD or postdoctoral studies at leading universities abroad.
Award Details: Faculty for the Future grants are based on actual costs for eligible expenses up to a maximum of USD 50,000 per year and may be renewed through to completion of studies
Application Deadline: November 13th

Mathematics Research Fellowships for Developing Countries
Scholarship Provider: The Abdus Salam International Centre for Theoretical Physics (ICTP)
Eligible Students: Visiting Fellows must have a PhD in mathematics prior to the start of their Fellowship.
Courses: These visiting Fellowships are open to mathematicians for pursuing research programme at ICTP.
Award Details: A small number of visiting fellowships will be awarded.
Application Deadline: 15 December

TWAS-icipe Fellowship Program
Scholarship Provider: The International Centre of Insect Physiology and Ecology (icipe)
Eligible Students: Applicant must be permanent residents in a developing country (other than Kenya)
Courses: Fellowships are available for undertaking PhD or postdoctoral studies.
Award Details: Icipe will provide a standard monthly allowance which should be used to cover living costs, such as accommodation, food and health insurance.
Application Deadline: 15th September

ISN Fellowship Program for Developing Countries’ Students
Scholarship Provider: International Society of Nephrology
Eligible Students: The candidates with the highest scores will be granted a fellowship.
Courses: Fellowship program provides relevant and contemporary nephrology training to physicians.
Award Details: The total sum of the grant is in alignment with the length of the training and varies according to the anticipated expenses in the host country, as per World Bank data.
Application Deadline: May 1st or October 1st

TWAS-CSIR Fellowship Programme
Scholarship Provider: Council of Scientific and Industrial Research, India
Eligible Students: Hold a PhD degree in a field of science or technology.
Courses: Fellowships are available for pursuing research at postgraduate and postdoctoral level at laboratories and institutes
Award Details: CSIR will provide a monthly stipend to cover for living costs, food and health insurance
Application Deadline: 31st August of each year

SFIAR Awards for Developing Countries Students in Switzerland
Scholarship Provider: The Swiss Forum for International Agricultural Research (SFIAR)
Eligible Students: Applicant has appropriate linkages in developing countries.
Courses: This award is available for pursuing PhD or postdoctoral level.
Award Details: The prize sum of the SFIAR Award is CHF 5’000 for a PhD or Post Doc project and CHF 10’000 for a team project. 
Application Deadline: 20 November

International Students House Residential Scholarships
Scholarship Provider: (ISH) International Students House
Eligible Students: Students should be from a developing or emerging country and intending to return on completion of their studies.
Courses: This is a two year residential scholarship program for postgraduate students.
Award Details: ISH provides a range of residential scholarships which provide free accommodation at ISH for up to a year and in exceptional circumstances up to three years. 
Application Deadline: 30 June

The Bioinformatics and Systems Biology Unit of Université de Liège (Belgium) is looking for a highly motivated master student with programming skills for a PhD thesis project (4 years, fully funded) with the goal of designing computational tools that use literature, genomic and structural data in order to infer regulatory and metabolic networks.

Applicants are invited to send their resume and a recommendation letter to Prof. Patrick Meyer (more details at www.biosys.ulg.ac.be )

For more information : www.biosys.ulg.ac.be

Handle sequence locations for bioinformatics http://www.ingolia-lab.org/seqloc-tutorial.html

Address of the bookmark: http://www.stackage.org/snapshot/nightly-2014-12-28/package/seqloc-0.6

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

• Function(data, options)

Even quit is a function

• q()

So is help

help(read.table)

Provides the help page for the FUNCTION ‘read.table’

help.search(“t test”)

Searches for help pages that might relate to the phrase ‘t test’

NOTE: quotes are needed for search strings, they are not needed when referring to data objects or function names.

There is a short cut for help,

? shows the help page on a function name, same as help(function)

?read.table

?? searches for help pages on functions, same as help.search(‘phrase’)

??“t test”

Information is usually returned from a function, by default this is printed to screen

read.table(‘data.tsv’)

This can always be stored, we call what it is stored in an ‘object’

mydata

here mydata is an object of type dataframe

Reminder:

• Vector: a list of numbers, equivalent to a column in a table
• Data Frame = a collection of vectors. Equivalent to a table

Hint:

• Up/Down arrow keys can be use to cycle through previous commands

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}