If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

This is a short post giving steps on how to actually install R packages. Let’s suppose you want to install the ggplot2 package. Well nothing could be easier. We just fire up an R shell and type:

> install.packages("ggplot2")

In theory the package should just install, however:

• if you are using Linux and don’t have root access, this command won’t work.
• you will be asked to select your local mirror, i.e. which server should you use to download the package.

Installing packages without root access

First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory /data/Rpackages/ After creating a package directory, to install a package we use the command:

> install.packages("ggplot2", lib="/data/Rpackages/")
> library(ggplot2, lib.loc="/data/Rpackages/")


It’s a bit of a pain having to type /data/Rpackages/ all the time. To avoid this burden,  we create a file .Renviron in our home area, and add the line R_LIBS=/data/Rpackages/ to it. This means that whenever you start R, the directory /data/Rpackages/ is added to the list of places to look for R packages and so:

> install.packages("ggplot2")
> library(ggplot2)

just works!

Setting the repository

Every time you install a R package, you are asked which repository R should use. To set the repository and avoid having to specify this at every package install, simply:

• create a file .Rprofile in your home area.
• Add the following piece of code to it:


cat(".Rprofile: Setting UK repositoryn")
r = getOption("repos") # hard code the UK repo for CRAN
r["CRAN"] = "http://cran.uk.r-project.org"
options(repos = r)
rm(r)


I found this tip in a stackoverflow answer .

More at http://www.binc.co.in/College/Index_New.aspx

BINC notification http://www.binc.co.in/PdfDocuments/Notification.pdf

Few dates to remember:

Starting of online submission of application: March 9, 2015
Last date for submission of application: April 30,2015
Examination consists of two parts:
Part I (Paper I) : June 7, 2015 (10 AM-12 PM)
Part II ( Paper II & III) :June 28, 2015 (9 AM-12 PM & 2 PM-4 PM)

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

• Expansion of Protists and Fungi with hundreds of annotated genomes
• Variation data for bread wheat, rice, Aedes aegypti, and Ixodes scapularis
• Whole genome alignments for O. longistaminata and T. cacao
• Non-coding RNA gene models in Bacteria
• New assembly of tomato (version 2.50)
• Full support for UCSC Track Hub format for hosting your own data in Ensembl

More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/

The OpenCPU JavaScript client library provides the most seamless integration of R and JavaScript available today.

OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source example apps are available from Github.

Installing your own OpenCPU server is super easy and only takes a few minutes.

More at https://www.opencpu.org/

In fact, there are huge demands for expert biological data analyst. It’s a fairly new  (not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.

The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.

Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:

1. Highly Skilled - programming skills, experience with the biological software and tools.

The biological data won’t illuminate much if the scientist analysing it doesn’t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.

2. Insight - Real vision, robust understanding and deep insight.

In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.

3. Energetic – Curiosity to explore

Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.

4. Researcher – Publications

Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.

5. Impressive communicator - Insight that can’t be expressed is worthless.

Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician  should know how to present the data and tell a scientific story through numbers/images.