RA / Research Associate (Bioinformatics/Computational Biologist)
Salary: Rs. 23000/- + HRA
Vacancy: 1
Essential Qualifications: PhD, preferably in plant biotechnology/biochemistry/Bioinformatics with experience in analyzing high throughput omics-based data. Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, managing the project portal, preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.

Address: Prof Indira Ghosh, room #12 Project Investigator, (Core Metabolomics) School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067.

Apply Details
Last Date: March 3rd 2015
Web/Notification URL http://www.jnu.ac.in/Career/currentjobs. htm

If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this tutorial on how to transition from Excel to R by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.

You'll likely still be using Excel as a data source, though, so you'll also want to check out this guide to importing data from Excel to R from MilanoR.

Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/

This is a short post giving steps on how to actually install R packages. Let’s suppose you want to install the ggplot2 package. Well nothing could be easier. We just fire up an R shell and type:

> install.packages("ggplot2")

In theory the package should just install, however:

• if you are using Linux and don’t have root access, this command won’t work.
• you will be asked to select your local mirror, i.e. which server should you use to download the package.

Installing packages without root access

First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory /data/Rpackages/ After creating a package directory, to install a package we use the command:

> install.packages("ggplot2", lib="/data/Rpackages/")
> library(ggplot2, lib.loc="/data/Rpackages/")


It’s a bit of a pain having to type /data/Rpackages/ all the time. To avoid this burden,  we create a file .Renviron in our home area, and add the line R_LIBS=/data/Rpackages/ to it. This means that whenever you start R, the directory /data/Rpackages/ is added to the list of places to look for R packages and so:

> install.packages("ggplot2")
> library(ggplot2)

just works!

Setting the repository

Every time you install a R package, you are asked which repository R should use. To set the repository and avoid having to specify this at every package install, simply:

• create a file .Rprofile in your home area.
• Add the following piece of code to it:


cat(".Rprofile: Setting UK repositoryn")
r = getOption("repos") # hard code the UK repo for CRAN
r["CRAN"] = "http://cran.uk.r-project.org"
options(repos = r)
rm(r)


I found this tip in a stackoverflow answer .

More at http://www.binc.co.in/College/Index_New.aspx

BINC notification http://www.binc.co.in/PdfDocuments/Notification.pdf

Few dates to remember:

Starting of online submission of application: March 9, 2015
Last date for submission of application: April 30,2015
Examination consists of two parts:
Part I (Paper I) : June 7, 2015 (10 AM-12 PM)
Part II ( Paper II & III) :June 28, 2015 (9 AM-12 PM & 2 PM-4 PM)

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

• Expansion of Protists and Fungi with hundreds of annotated genomes
• Variation data for bread wheat, rice, Aedes aegypti, and Ixodes scapularis
• Whole genome alignments for O. longistaminata and T. cacao
• Non-coding RNA gene models in Bacteria
• New assembly of tomato (version 2.50)
• Full support for UCSC Track Hub format for hosting your own data in Ensembl

More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/

The OpenCPU JavaScript client library provides the most seamless integration of R and JavaScript available today.

OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source example apps are available from Github.

Installing your own OpenCPU server is super easy and only takes a few minutes.

More at https://www.opencpu.org/