<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/2573?</link>
	<atom:link href="https://bioinformaticsonline.com/related/2573?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata</guid>
	<pubDate>Tue, 11 Jun 2019 21:27:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39606/amity-university-bioinformatics-summer-program-kolkata</link>
	<title><![CDATA[Amity University Bioinformatics Summer Program - Kolkata]]></title>
	<description><![CDATA[<p>Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.</p><p>Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43292/bioinformatics-scientist-production-bioinformatics-south-san-francisco-ca</guid>
  <pubDate>Thu, 19 Aug 2021 08:45:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Scientist, Production Bioinformatics @ South San Francisco, CA]]></title>
  <description><![CDATA[
<p>wist is looking for a Bioinformatics Scientist to join our Production Bioinformatics Team. You will work alongside research scientists, software engineers and data scientists to further deliver on our mission to expand access to best-in-class synthetic biology and next-generation sequencing applications. You will be developing and engineering tools to better evaluate and build hardened, production quality pipelines, optimize data quality, and automate lab and bioinformatics processes. Our ideal candidate is an organized problem solver with a background in developing and building novel production-quality bioinformatics tools and packages. Equally excellent communication skills and a proven ability to work independently are required.</p>

<p>More at https://boards.greenhouse.io/twistbioscience/jobs/3135495?gh_src=9ecc0b941us</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</guid>
	<pubDate>Sat, 21 May 2016 22:42:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</link>
	<title><![CDATA[Bpipe - a tool for running and managing bioinformatics pipelines]]></title>
	<description><![CDATA[<p>Bpipe provides a platform for running big bioinformatics jobs that consist of a series of processing stages - known as 'pipelines'.</p>
<ul>
<li>January 20th, 2016 - New! Bpipe 0.9.9 released!</li>
<li>Download <a href="http://download.bpipe.org/versions/bpipe-0.9.9.tar.gz">latest</a>, <a href="http://download.bpipe.org">all</a></li>
<li><a href="http://docs.bpipe.org">Documentation</a></li>
<li><a href="https://groups.google.com/forum/#%21forum/bpipe-discuss">Mailing List</a> (Google Group)</li>
</ul>
<p>Bpipe has been published in <a href="http://bioinformatics.oxfordjournals.org/content/early/2012/04/11/bioinformatics.bts167.abstract">Bioinformatics</a>! If you use Bpipe, please cite:</p>
<p><em>Sadedin S, Pope B &amp; Oshlack A, Bpipe: A Tool for Running and Managing Bioinformatics Pipelines, Bioinformatics</em></p><p>Address of the bookmark: <a href="http://docs.bpipe.org/" rel="nofollow">http://docs.bpipe.org/</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43272/bioinformatics-head-bioinformatics-manager-iii-cancer-genomics-research-laboratory-at-frederick-national-laboratory</guid>
  <pubDate>Wed, 18 Aug 2021 00:19:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Head (Bioinformatics Manager III), Cancer Genomics Research Laboratory at  Frederick National Laboratory]]></title>
  <description><![CDATA[
<p>Frederick National Laboratory seeking an enthusiastic, creative, and seasoned bioinformatics professional to join our leadership team and direct the exceptional Bioinformatics Group at the Cancer Genomics Research Laboratory (CGR).  CGR has a diverse team of bioinformatics and computational scientists that support all areas of bioinformatics and data analysis (infrastructure, data QC, pipeline development and maintenance, data curation and sharing, methodology development, statistical analyses, machine learning approaches, and scientific interpretation).</p>

<p>More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&amp;c=leidosbiomed&amp;id=2040</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43559/job-offer-for-a-postdoctoral-researcher-in-genomics-bioinformatics-2-years</guid>
  <pubDate>Fri, 22 Oct 2021 04:44:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Job offer for a postdoctoral researcher in genomics / bioinformatics (2 years)]]></title>
  <description><![CDATA[
<p>Ongoing research in the group of Karine Van Doninck involves topics at the core of<br />evolutionary biology, including the evolution of sex, genome maintenance,<br />recombination and extreme stress resistance on different eukaryotic systems,<br />including rotifers, amoeba and Corbicula clams. We are employing different tools<br />(including experimental ecology, population genetics, phylogeny, comparative<br />genomics, transcriptomics, bioinformatics, molecular and cellular biology) to study<br />evolutionary processes at the level of populations, both experimental and natural, and<br />genomes.</p>

<p>Offer<br />We offer a full-time contract for two years. The contract starts between October 2021<br />and December 2021. The position involves no or extremely light teaching load, if the<br />candidate is interested. Salaries are competitive at the European level. The recruited<br />person will benefit from the Belgian social insurance scheme (health care, etc.) without<br />additional expenses.</p>

<p>Profile<br />Applicants are expected to show outstanding commitment to research and must have<br />obtained a PhD by the start of the position. A strong expertise in genomics is required.<br />More specifically, solid competences in bioinformatics (e.g. scripting pipelines) and in<br />genome evolution are needed. Knowledge or interest regarding recombination,<br />metazoan evolution, phylogenomics and population genomics is an added-value.</p>

<p>Application<br />Applications should be submitted via email to karine.van.doninck@ulb.be. The<br />application package should contain the following documents:<br />- A curriculum vitae with the complete list of publications<br />- A cover letter mentioning why the candidate is interested in the position<br />- Minimum 2 recommendation letters<br />Interviews: Interviews will be conducted with the selected candidates. Selected<br />candidates could also be invited to give a seminar to MBE ULB.<br />For any additional information, please contact karine.van.doninck@ulb.be</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7813/research-associate-indian-institute-of-spices-research</guid>
  <pubDate>Wed, 08 Jan 2014 10:10:03 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ INDIAN INSTITUTE OF SPICES RESEARCH]]></title>
  <description><![CDATA[
<p>INDIAN INSTITUTE OF SPICES RESEARCH<br />(Indian Council of Agricultural Research)<br />Marikunnu P.O., Kozhikode – 673 012, Kerala</p>

<p>Phone No. 0495 2731 410</p>

<p>WALK -IN- TEST CUM INTERVIEW<br />Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) &amp; Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.</p>

<p>Research Associate<br />Date of Interview : 21 -01-2014 at 10.00 A.M<br />Qualifications :<br />a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in  Bioinformatics as evidenced by publications.<br />OR Three years research experience after  MVSc/MPharm/ME/MTech with Bioinformatics Specialization.<br />b Desirable: Experience in handling NGS data  Programming skills in Python/Bioperl<br />Emoluments : Rs:22000/- per month + HRA  (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.<br />Upper age limit : 40 years for Men &amp; 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)<br />Duration of Project : Till the closure of the project.</p>

<p>General Terms and conditions<br />1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project.<br />The selected candidate will not have any right for claiming pay scale or absorption<br />against any regular post being vacant on a later date at this Institute.<br />2 . No TA/DA will be paid for attending the Interview.<br />3. Canvassing in any form will lead to cancellation of candidate.<br />4. The decision of Director, IISR would be final and binding in all aspects.<br />5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.<br />6. Candidates who secure the minimum marks prescribed by the Institute in written test  only will be eligible for calling for the interview. The number of candidates to be  called for the interview will be decided by the Director of the Institute.<br />7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.</p>

<p>Note: All relevant certificates (in original) and bio data, No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.<br />Advertisement: http://spicebioinfo.res.in/downloads/DISC-Website.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43943/bioinformatics-tutorial</guid>
	<pubDate>Mon, 22 Aug 2022 23:56:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43943/bioinformatics-tutorial</link>
	<title><![CDATA[Bioinformatics Tutorial !]]></title>
	<description><![CDATA[<p>This site aims to be a useful resource for bioinformatics beginners. Feel free to jump right in with the section most relevant to you, and if you're not sure, then the place to start is definitely Unix <p>Address of the bookmark: <a href="https://astrobiomike.github.io/" rel="nofollow">https://astrobiomike.github.io/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>