<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26303?offset=1050</link>
	<atom:link href="https://bioinformaticsonline.com/related/26303?offset=1050" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4351/cpcri-kasaragod-bioinformatics-pa</guid>
  <pubDate>Sat, 07 Sep 2013 14:15:53 -0500</pubDate>
  <link></link>
  <title><![CDATA[CPCRI Kasaragod Bioinformatics PA]]></title>
  <description><![CDATA[
<p>CENTRAL PLANTATION CROPS RESEARCH INSTITUTE<br />(Indian Council of Agricultural Research)<br />KASARAGOD -671 124, KERALA</p>

<p>WALK-IN-INTERVIEW</p>

<p>Walk-in-test cum interview for selection to the following temporary assignments sanctioned under the DBT sponsored adhoc time bound research scheme entitled "Establishment of a Sub-DIC" will be held at CPCRl, Kudlu PO, Kasaragod District, Kerala -6711 24 on the date and time indicated against each:</p>

<p>Project Assistant</p>

<p>    Qualification: Essential: Masters Degree in Bioinformatics / B.Tech Degree in Bioinformatics</p>

<p>    Desirable: 1. Experience in the field of bioinformatics<br />    2. M.Phil / Doctoral degree in the field</p>

<p>    Date of interview 24.09.2013 at 10.00 a.m.</p>

<p>Trainee – 2 Posts</p>

<p>    Essential: Masters Degree in Bioinformatics or B.Tech Degree in Bioinformatics.</p>

<p>    Date of interview 25.09.2013 at 10.00 a.m.</p>

<p>Studentship – 2 Posts</p>

<p>    Essential Final Year/Semester students of MSc Bioinformatics or B.Tech Bioinformatics</p>

<p>    Date of Interview 25.09.2013 at 10.00 a.m.</p>

<p>The candidates fulfilling the above eligibility criteria for Item No.1 &amp; II shall apply online and walk-in for a written test and interview at CPCRI, Kasaragod on the respective dates at 10.00 a.m. The candidates for Studentship should submit the application through their Head of the Department. They shall also bring with them a set of bio data and original certificates in proof of age, educational qualifications, experience etc. Candidates who fail to produce the original of the Degree/PO certificates OR provisional certificate will not be allowed to attend the test / interview. Those who are qualified in written test will only be permitted to attend the interview.</p>

<p>No TA will be paid for the journey for attending the interview.</p>

<p>Advertisement: http://www.cpcri.gov.in/images/images/opportunity/sep4_opp.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4654/la-trobe-university-melbourne-australia</guid>
  <pubDate>Fri, 20 Sep 2013 13:05:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[La Trobe University, Melbourne, Australia]]></title>
  <description><![CDATA[
<p>La Trobe University, Melbourne, Australia</p>

<p>An exciting opportunity exists for a highly motivated and enthusiastic bioinformatics researcher to work in the Exosome, Secretome and Systems Biology laboratory of Dr Suresh Mathivanan. This position is funded through the National Institutes of Health (NIH) USA, to study the role of extracellular RNA or ExRNA in intercellular communication.</p>

<p>The successful applicant will be involved in collaborative bioinformatics research with more than 30 American Universities/Institutes.  The ExRNA consortium is a multi-institute USD 17 million funded program which has 5 primary aims: to understand the biogenesis of ExRNA (vesicles and non-vesicles), to explore the use of ExRNA in biomarker research, to establish a reference profile of ExRNA in various disease conditions, to explore the role of ExRNA in therapeutic purposes and to manage the generated data through a reference portal.  The bioinformatics component is critical in managing and analysing the data generated by the entire consortium.  The researcher is required to contribute to the management and perform the analysis of ExRNA data.</p>

<p>The candidate to succeed, you will possess:</p>

<p>Experience in the analysis and modelling of data, including the capacity to integrate data from a range of sources and of uneven quality.</p>

<p>Evidence of experience in research and of the ability to work effectively under limited supervision or independently.</p>

<p>A record of contribution to publications, conference papers and/or reports, or professional or technical contributions which provide evidence of research potential.</p>

<p>Completion of a doctoral degree in bioinformatics or biostatistics with a focus on transcriptomic data will be highly regarded.</p>

<p>Preference will be given to applicants with competence in programming (JavaScript, Perl/Python), any web-based applications (PHP, ZOPE) and relational databases (MySQL).</p>

<p>Closing date:  30 September 2013</p>

<p>Position Enquiries: Dr Suresh Mathivanan (s.mathivanan@latrobe.edu.au)</p>

<p>More at http://www.mathivananlab.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4947/experimental-scientific-officer-bioinformatics</guid>
  <pubDate>Fri, 27 Sep 2013 11:09:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Experimental Scientific Officer (Bioinformatics)]]></title>
  <description><![CDATA[
<p>Closing Date:  8 October 2013</p>

<p>Salary:   £27,854 - £29,541, with progression to £36,298</p>

<p>You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.</p>

<p>You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.</p>

<p>This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.</p>

<p>Tenable for three years.</p>

<p>Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk</p>

<p>For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&amp;jobid=50667,2552984041&amp;key=70203469&amp;c=725434237887&amp;pagestamp=sepghtjhowdqpsxuyn</p>

<p>You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</guid>
	<pubDate>Thu, 10 Oct 2019 22:12:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</link>
	<title><![CDATA[Naegleria fowleri: brain eating amoebae]]></title>
	<description><![CDATA[<div><em>Naegleria fowleri</em>&nbsp;is a free living, universally distributed amoeba, which is mostly found in natural, stagnant, warm water bodies such as ponds, lakes, etc. It is also reported to be present even in indoor water bodies, such as swimming pools within a temperature range of 40&ndash;45&deg;C.&nbsp;</div><div>&nbsp;</div><div><img src="https://d.newsweek.com/en/full/351971/naegleria-fowleri.jpg" alt="image" width="720" height="634" style="border: 0px; border: 0px;">&nbsp;</div><div><em style="font-size: 12.8px;">N. fowleri</em>&nbsp;infects the central nervous system of human body by entering through the nose during swimming and outdoor baths in natural stagnant water bodies, leading to meningoencephalitis. It is a condition of inflammation of cerebral tissues and membranes of the brain and is mostly fatal in nature. Casualties due to N. fowleri infections are reported all across the globe including a few in India but only seven survivors in the entire world have been reported till 2015.</div><div>&nbsp;</div><div>You can find two genome assembly at&nbsp;</div><div><a href="https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri">https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri</a></div><div>&nbsp;</div><div>More at&nbsp;<a href="https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri">https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri</a></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42158/rgcb-recruitment-notification-for-bioinformatician</guid>
  <pubDate>Tue, 25 Aug 2020 00:25:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[RGCB recruitment notification for bioinformatician !]]></title>
  <description><![CDATA[
<p>RGCB Jobs 2020: RGCB released the recruitment notification to hire the candidates who completed B.Tech, M.Sc for 01 Bioinformatician Posts. The eligible candidates can apply for the post through online from 22-08-2020 to 08-09-2020. These selected candidates will be placed as Bioinformatician in Kerala. To know more details such as salary (pay scale), age limit, application fee, application process and more for RGCB recruitment 2020 by clicking apply button.<br />Organization Name : Rajiv Gandhi Centre for Biotechnology<br />Post Name : Bioinformatician<br />No of Vacancy : 01 Posts<br />Salary : Rs.22,000 (Per Month)<br />Last Date to Apply : 08-09-2020</p>

<p>More at https://rgcb.res.in/jobs.php</p>
]]></description>
</item>

</channel>
</rss>