Position Paper Submission Extension: October 9, 2014 
Regular Paper Authors Notification: November 3, 2014 
Position Paper Authors Notification: November 6, 2014 
Regular and Position Paper Camera Ready and Registration: November 17, 2014 

Address of the bookmark: http://www.bioinformatics.biostec.org/

• Bioconductor – A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [ paper-2004 | web ]
• Biopython – Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the Open Bioinformatics Foundation. Contains the very useful Entrez package for API access to the NCBI databases. [ paper-2009 | web ]
• Bioconda – A channel for the conda package manager specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with conda install) bioinformatics packages. [ paper-2018 | web ]
• BioJulia – Bioinformatics and computational biology infastructure for the Julia programming language. [ web ]
• Rust-Bio – Rust implementations of algorithms and data structures useful for bioinformatics. [ paper-2016 ]
• SeqAn – The modern C++ library for sequence analysis.

WALK-IN-INTERVIEW

Walk-in-test cum interview for selection to the following temporary assignments sanctioned under the DBT sponsored adhoc time bound research scheme entitled "Establishment of a Sub-DIC" will be held at CPCRl, Kudlu PO, Kasaragod District, Kerala -6711 24 on the date and time indicated against each:

Project Assistant

Qualification: Essential: Masters Degree in Bioinformatics / B.Tech Degree in Bioinformatics

Desirable: 1. Experience in the field of bioinformatics
2. M.Phil / Doctoral degree in the field

Date of interview 24.09.2013 at 10.00 a.m.

Trainee – 2 Posts

Essential: Masters Degree in Bioinformatics or B.Tech Degree in Bioinformatics.

Date of interview 25.09.2013 at 10.00 a.m.

Studentship – 2 Posts

Essential Final Year/Semester students of MSc Bioinformatics or B.Tech Bioinformatics

Date of Interview 25.09.2013 at 10.00 a.m.

The candidates fulfilling the above eligibility criteria for Item No.1 & II shall apply online and walk-in for a written test and interview at CPCRI, Kasaragod on the respective dates at 10.00 a.m. The candidates for Studentship should submit the application through their Head of the Department. They shall also bring with them a set of bio data and original certificates in proof of age, educational qualifications, experience etc. Candidates who fail to produce the original of the Degree/PO certificates OR provisional certificate will not be allowed to attend the test / interview. Those who are qualified in written test will only be permitted to attend the interview.

No TA will be paid for the journey for attending the interview.

Advertisement: http://www.cpcri.gov.in/images/images/opportunity/sep4_opp.pdf

An exciting opportunity exists for a highly motivated and enthusiastic bioinformatics researcher to work in the Exosome, Secretome and Systems Biology laboratory of Dr Suresh Mathivanan. This position is funded through the National Institutes of Health (NIH) USA, to study the role of extracellular RNA or ExRNA in intercellular communication.

The successful applicant will be involved in collaborative bioinformatics research with more than 30 American Universities/Institutes. The ExRNA consortium is a multi-institute USD 17 million funded program which has 5 primary aims: to understand the biogenesis of ExRNA (vesicles and non-vesicles), to explore the use of ExRNA in biomarker research, to establish a reference profile of ExRNA in various disease conditions, to explore the role of ExRNA in therapeutic purposes and to manage the generated data through a reference portal. The bioinformatics component is critical in managing and analysing the data generated by the entire consortium. The researcher is required to contribute to the management and perform the analysis of ExRNA data.

The candidate to succeed, you will possess:

Experience in the analysis and modelling of data, including the capacity to integrate data from a range of sources and of uneven quality.

Evidence of experience in research and of the ability to work effectively under limited supervision or independently.

A record of contribution to publications, conference papers and/or reports, or professional or technical contributions which provide evidence of research potential.

Completion of a doctoral degree in bioinformatics or biostatistics with a focus on transcriptomic data will be highly regarded.

Preference will be given to applicants with competence in programming (JavaScript, Perl/Python), any web-based applications (PHP, ZOPE) and relational databases (MySQL).

Closing date: 30 September 2013

Position Enquiries: Dr Suresh Mathivanan (s.mathivanan@latrobe.edu.au)

More at http://www.mathivananlab.org/

• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

Bii.a-star.edu.sg

Bio research and development. Has course information and research information.

Isb-sib.ch

SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.

Bioinformatics.ca

Provides information about bioinformatics in Canada. Workshops, certification and resources.

Chickscope.beckman.uiuc.edu

Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.

Bcb.iastate.edu

Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).

Bu.edu/bioinformatics/

Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.

Bioinformatics.ubc.ca

A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.

Openhelix.com

Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.

Igb.uci.edu

Specializing in making publicly available software and database services for computational biology.

Bioinformatics.pe.kr

Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.

Groups.yahoo.com/group/bimatics/

Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.

Ncbi.nlm.nih.gov/books/NBK22183/

Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.

Bioinfo.mbb.yale.edu/mbb452a/2003/

Bioinformatics course at Yale University. All course slides are available online.

Cs.iastate.edu/~honavar/comp-bio-courses.html

Listing of computational molecular biology course pages that have extensive online course materials.

Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html

A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.

Northeastern.edu/bioinformatics/

From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.

Biocomp.unibo.it/lsbioinfo/

A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.

Cs.helsinki.fi/bioinformatiikka/mbi/programme.html

A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.

Ornl.gov/sci/techresources/Human_Genome/education/education.shtml

A resource for introductory information on the Human Genome Project.

His.se/bioinformatics

A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.

Members.tripod.com/C.elegans/

Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.

Bioinformatics.org/faq/#contents

Summary of basics of bioinformatics for the intelligent newcomer.

Jiscmail.ac.uk/archives/bioinformatics.html

Forum featuring various aspects, events and developments in the bioinformatics field.

Biinoida.blogspot.com

Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.

Colorbasepair.com/bioinformatics_courses_tutorials.html

A list of on-line course materials and tutorials for bioinformatics and computational biology.

Geospiza.com/education/

Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.

Bioinformatics.fi

An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.

Perlsource.net

Provides online courses in Perl programming for bioinformatic tools.

The programs and the package are free software for academic users. Permission to use, copy, and modify any part of this software for educational, research and non-profit purposes is hereby granted. In this package or Docker image, number of other supported software has been integrated which may be under other licenses, along with any direct or indirect dependencies of the primary software being contained. As for any pre-built image usage, it is the image user's responsibility to ensure that any use of this image complies with any relevant licenses for all software contained within.

All software packages are distributed in the hope that they will be useful but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. If you have any query, please contact at raghava@iiitd.ac.in.

Address of the bookmark: https://hub.docker.com/r/raghavagps/gpsrdocker/

Seq is a programming language for computational genomics and bioinformatics. With a Python-compatible syntax and a host of domain-specific features and optimizations, Seq makes writing high-performance genomics software as easy as writing Python code, and achieves performance comparable to (and in many cases better than) C/C++.

Learn more by following the tutorial or from the cookbook.

Address of the bookmark: https://seq-lang.org