<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26303?offset=1260</link>
	<atom:link href="https://bioinformaticsonline.com/related/26303?offset=1260" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</guid>
	<pubDate>Mon, 10 Feb 2014 05:57:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</link>
	<title><![CDATA[List of generic simulation software/tools/resource with brief description and homepage !!!]]></title>
	<description><![CDATA[<p>List of generic simulation software/tools/resource with brief description and homepage</p><p><img src="http://www.evolution-of-life.com/fileadmin/images/carousel/genetic.PNG" alt="image" style="border: 0px;"></p><p>ALF <br />A Simulation Framework for Genome Evolution <br />http://www.cbrg.ethz.ch/alf<br /><br />Bayesian Serial SimCoal <br />Bayesian Serial SimCoal, (BayeSSC) is a modification of SIMCOAL 1.0, a program written by Laurent Excoffier, John Novembre, and Stefan Schneider. <br />http://www.stanford.edu/group/hadlylab/ssc/index.html<br /><br />BEERS <br />BEERS was designed to benchmark RNA-Seq alignment algorithms and also algorithms that aim to reconstruct different isoforms and alternate splicing from RNA-Seq data <br />http://cbil.upenn.edu/beers/<br /><br />BOTTLENECK <br />Bottleneck is a program for detecting recent effective population size reductions from allele data frequencies <br />http://www.ensam.inra.fr/urlb/bottleneck/bottleneck.html<br /><br />BottleSim <br />BottleSim is a computer simulation program for simulating the process of population bottlenecks <br />http://chkuo.name/software/bottlesim.html<br /><br />CASS <br />Protein Sequence Simulation <br />http://www.wyomingbioinformatics.org/liberlesgroup/cass/<br /><br />CDPOP <br />CDPOP is a landscape genetics tool for simulating the emergence of spatial genetic structure in populations resulting from specified landscape processes governing organism movement behavior. <br />http://cel.dbs.umt.edu/cdpop<br /><br />CoalFace <br />CoalFace is a simulation of the coalescent process with the visual display of gene genealogies. <br />http://web.up.ac.za/default.asp?ipkcategoryid=3283<br /><br />CoaSim <br />CoaSim is a tool for simulating the coalescent process with recombination and geneconversion under various demographic models. <br />http://users-birc.au.dk/mailund/coasim/index.html<br /><br />cosi <br />The cosi package is written in C and is available as a tar file. <br />http://www.broadinstitute.org/~sfs/cosi/<br /><br />CS-PSeq-Gen <br />A program to simulate the evolution of protein sequences under the constraints of the information of a particular reconstructed phylogeny <br />http://bioserv.rpbs.univ-paris-diderot.fr/software/cs-pseq-gen.html<br /><br />DAWG <br />An application designed to simulate the evolution of recombinant DNA sequences in continuous time <br />http://scit.us/projects/dawg<br /><br />Easypop <br />EASYPOP is an individual based model intended to simulate datasets under a very broad range of conditions <br />http://www.unil.ch/dee/page36926_fr.html<br /><br />EggLib <br />EggLib is a C++/Python library and program package for evolutionary genetics and genomics. <br />http://egglib.sourceforge.net/<br /><br />EvolSimulator <br />A simulation test bed for hypotheses of genome evolution <br />http://acb.qfab.org/acb/evolsim/<br /><br />EvolveAGene <br />A realistic coding sequence simulation program that separates mutation from selection and allows the user to set selection conditions <br />http://bellinghamresearchinstitute.com/software/index.html<br /><br />fastsimcoal <br />A continuous-&not;‐time coalescent simulator of genomic diversity under arbitrarily complex evolutionary scenarios <br />http://cmpg.unibe.ch/software/fastsimcoal/<br /><br />FastSLINK <br />Simulation of Marker and Phenotype Data in Pedigrees <br />http://watson.hgen.pitt.edu/<br /><br />FFPopSim <br />C++/Python library for population genetics. <br />http://webdav.tuebingen.mpg.de/ffpopsim/<br /><br />FLUX SIMULATOR <br />The Flux Simulator aims at providing a deterministic in silico reproduction of the experimental pipelines for RNA-Seq, employing a minimal set of parameters. <br />http://flux.sammeth.net/simulator.html<br /><br />ForSim <br />ForSim: A Forward Evolutionary Computer Simulation <br />http://www.anthro.psu.edu/weiss_lab/research.shtml<br /><br />ForwSim <br />The program given below is based on the algorithm described in Padhukasahasram et al. 2008 to simulate genetic drift in a standard Wright-Fisher process. <br />http://badri-populationgeneticsimulators.blogspot.com/<br /><br />FPG <br />Forward Population Genetic simulation <br />http://genfaculty.rutgers.edu/hey/software#fpg<br /><br />FREGENE <br />FREGENE is a C++ program that simulates sequence-like data over large genomic regions in large diploid populations. <br />http://www.ebi.ac.uk/projects/bargen/download/fregen/documentation_html.html<br /><br />GAMETES <br />Genetic Architecture Model Emulator for Testing and Evaluating Software: Simulates complex SNP models with pure, strict epistatic interactions with n-loci. <br />http://sourceforge.net/projects/gametes/?source=navbar<br /><br />GASP <br />Genometric Analysis Simulation Program. A software tool for testing and investigating methods in statistical genetics by generating samples of family data based on user specified models. <br />http://research.nhgri.nih.gov/gasp/<br /><br />GemSIM <br />Next generation sequencing read simulator <br />http://sourceforge.net/projects/gemsim/<br /><br />GeneArtisan <br />Simulation of Markers in Case-Control Study Designs <br />http://www.rannala.org/?page_id=241<br /><br />GENOME <br />A rapid coalescent-based whole genome simulator <br />http://www.sph.umich.edu/csg/liang/genome/<br /><br />GenomePop2 <br />GenomePop2 is a specialization of the program GenomePop just to manage SNPs under more flexible and useful settings. If you need models with more than 2 alleles please use the GenomePop program version. <br />http://webs.uvigo.es/acraaj/genomepop2.htm<br /><br />GenomeSimla <br />GenomeSIMLA is currently under development- however, we have a beta release that we are asking to be tested <br />http://chgr.mc.vanderbilt.edu/genomesimla/<br /><br />GENS2 <br />Simulates interactions among two genetic and one environmental factor and also allows for epistatic interactions. <br />https://sourceforge.net/projects/gensim/<br /><br />GWAsimulator <br />A rapid whole genome simulation program <br />http://biostat.mc.vanderbilt.edu/wiki/main/gwasimulator<br /><br />HAP-SAMPLE <br />An association simulator for candidate regions or genome scans <br />http://www.hapsample.org/<br /><br />HAPGEN <br />A simulator for the simulation of case control datasets at SNP markers <br />https://mathgen.stats.ox.ac.uk/genetics_software/hapgen/hapgen2.html<br /><br />HapSim <br />A simulation tool for generating haplotype data with pre-specified allele frequencies and LD coefficients <br />http://cran.r-project.org/web/packages/hapsim/index.html<br /><br />HAPSIMU <br />A program that simulates heterogeneous populations with various known and controllable structures under the continuous migration model or the discrete model <br />http://l.web.umkc.edu/liujian/<br /><br />IBDsim <br />IBDSim is a computer package for the simulation of genotypic data under general isolation by distance models. <br />http://raphael.leblois.free.fr/<br /><br />indel-Seq-Gen <br />A biological sequence simulation program that simulates highly divergent DNA sequences and protein superfamilies <br />http://bioinfolab.unl.edu/~cstrope/isg/<br /><br />Indelible <br />A powerful and flexible simulator of biological evolution <br />http://abacus.gene.ucl.ac.uk/software/indelible/<br /><br />invertFREGENE <br />InvertFREGENE is a forward-in-time simulator of inversions in population genetic data <br />http://www.ebi.ac.uk/projects/bargen/<br /><br />kernalPop <br />A spatially explicit population genetic simulation engine <br />http://cran.r-project.org/src/contrib/archive/kernelpop/<br /><br />MaCS <br />Markovian Coalescent Simulator <br />http://www-hsc.usc.edu/~garykche/<br /><br />Mason <br />A package for the simulation of nucleotide data. <br />http://www.seqan.de/projects/mason/<br /><br />mbs <br />modifying Hudson's ms software to generate samples of DNA sequences with a biallelic site under selection <br />http://www.sendou.soken.ac.jp/esb/innan/innanlab/software.html<br /><br />Mendel's Accountant <br />Mendel's Accountant (MENDEL) is an advanced numerical simulation program for modeling genetic change over time and was developed collaboratively by Sanford, Baumgardner, Brewer, Gibson and ReMine <br />http://mendelsaccount.sourceforge.net/<br /><br />MetaSim <br />A tool to generate collections of synthetic reads that reflect the diverse taxonomical composition of typical metagenome data sets <br />http://ab.inf.uni-tuebingen.de/software/metasim/<br /><br />mlcoalsim <br />Multilocus Coalescent Simulations <br />http://code.google.com/p/mlcoalsim-v1/<br /><br />ms <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/source/mksamples.html<br /><br />msHOT <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/<br /><br />msms <br />A coalescent Simlation tool with selection. <br />http://www.mabs.at/ewing/msms/index.shtml<br /><br />MySSP <br />A program for the simulation of DNA sequence evolution across a phylogenetic tree <br />http://www.rosenberglab.net/software.php<br /><br />Nemo <br />A forward-time, individual-based, genetically explicit, and stochastic simulation program designed to study the evolution of genetic markers, life history traits, and phenotypic traits in a flexible (meta-)population framework. <br />http://nemo2.sourceforge.net/<br /><br />NetRecodon <br />Coalescent simulation of coding DNA sequences with recombination (inter and intracodon), migration and demography <br />http://code.google.com/p/netrecodon/<br /><br />PEDAGOG <br />Software for simulating eco-evolutionary population dynamics <br />https://bcrc.bio.umass.edu/pedigreesoftware/node/5<br /><br />phenosim <br />A tool to add phenotypes to simulated genotypes <br />http://evoplant.uni-hohenheim.de/doku.php?id=software:software<br /><br />PhyloSim <br />An R package for the Monte Carlo simulation of sequence evolution <br />http://bit.ly/rlsim-git<br /><br />pIRS <br />Profile-based Illumina pair-end reads simulator <br />https://code.google.com/p/pirs/<br /><br />ProteinEvolver <br />Simulation of protein evolution along phylogenies under structure-based substitution models <br />http://code.google.com/p/proteinevolver/<br /><br />QMSim <br />QTL and Marker Simulator <br />http://www.aps.uoguelph.ca/~msargol/qmsim/<br /><br />quantiNEMO <br />An individual-based program for the analysis of quantitative traits with explicit genetic architecture potentially under selection in a structured population <br />http://www2.unil.ch/popgen/softwares/quantinemo/<br /><br />RECOAL <br />Simulates new haplotype data from a reference population of haplotypes. <br />ftp://popgen.usc.edu/<br /><br />Recodon <br />Coalescent simulation of coding DNA sequences with recombination, migration and demography <br />http://code.google.com/p/recodon/<br /><br />rlsim <br />A package for simulating RNA-seq library preparation with parameter estimation <br />http://bit.ly/rlsim-git<br /><br />Rmetasim <br />Rmetasim is a front-end for the metasim engine that is implemented as a package that runs in the statistical computing environment R <br />http://linum.cofc.edu/software.html#metasim<br /><br />RNA Seq Simulator <br />RSS takes SAM alignment files from RNA-Seq data and simulates over dispersed, multiple replica, differential, non-stranded RNA-Seq datasets. <br />http://useq.sourceforge.net/cmdlnmenus.html#rnaseqsimulator<br /><br />Rose <br />Random model of sequence evolution <br />http://bibiserv.techfak.uni-bielefeld.de/rose/<br /><br />SelSim <br />SelSim is a program for Monte Carlo simulation of DNA polymorphism data for a recom- bining region within which a single bi-allelic site has experienced natural selection <br />http://www.well.ox.ac.uk/~spencer/selsim/<br /><br />Seq-Gen <br />An application for the Monte Carlo simulation of molecular sequence evolution along phylogenetic trees. <br />http://tree.bio.ed.ac.uk/software/seqgen/<br /><br />SEQPower <br />Statistical power analysis for sequence-based association studies <br />http://bioinformatics.org/spower/<br /><br />SeqSIMLA <br />SeqSIMLA can simulate sequence data with user-specified disease and quantitative trait models. Family or unrelated case-control data can be simulated. <br />http://seqsimla.sourceforge.net/<br /><br />Serial NetEvolve <br />A flexible utility for generating serially-sampled sequences along a tree or recombinant network <br />http://biorg.cis.fiu.edu/sne/<br /><br />SFS_CODE <br />SFS_CODE can perform forward population genetic simulations under a general Wright-Fisher model with arbitrary migration, demographic, selective, and mutational effects. <br />http://sfscode.sourceforge.net/sfs_code/index/index.html<br /><br />SIBSIM <br />Quantitative phenotype simulation in extended pedigrees <br />http://sourceforge.net/projects/sibsim/<br /><br />SIMCOAL2 <br />A coalescent program for the simulation of complex recombination patterns over large genomic regions under various demographic models <br />http://cmpg.unibe.ch/software/simcoal2/<br /><br />SimCopy <br />An R package simulating the evolution of copy number profiles along a tree. <br />http://bit.ly/simcopy<br /><br />SIMLA <br />SIMLA is a SIMuLAtion program that generates data sets of families for use in Linkage and Association studies. <br />http://www.chg.duke.edu/research/simla.html<br /><br />SimPed <br />A Simulation Program to Generate Haplotype and Genotype Data for Pedigree Structures <br />http://www.hgsc.bcm.tmc.edu/content/simped<br /><br />Simprot <br />A program to simulate protein evolution by substitution, insertion and deletion <br />http://www.uhnresearch.ca/labs/tillier/software.htm#3<br /><br />SimRare <br />Rare variant simulation and analysis tool <br />http://code.google.com/p/simrare/<br /><br />simuGWAS <br />A forward-time simulator that simulates realistic samples for genome-wide association studies. <br />http://simupop.sourceforge.net/cookbook/simucomplexdisease<br /><br />simuPOP <br />simuPOP is a general-purpose individual-based forward-time population genetics simulation environment. <br />http://simupop.sourceforge.net/<br /><br />SISSI <br />A software tool to generate data of related sequences along a given phylogeny, taking into account user defined system of neighbourhoods and instantaneous rate matrices. <br />http://www.cibiv.at/software/sissi/<br /><br />SNPsim <br />Coalescent simulation of hotspot recombination <br />http://code.google.com/p/phylosoftware/<br /><br />SPIP <br />SPIP simulates the transmission of genes from parents to offspring in a population having demographic structure defined by the user <br />http://swfsc.noaa.gov/textblock.aspx?division=fed&amp;id=3434<br /><br />Splatche <br />Spatial and Temporal Coalescences in Heterogeneous Environment <br />http://www.splatche.com/<br /><br />srv <br />Simulator of Rare Varaints (srv) is a simulator for the simulation of the introduction and evolution of (rare) genetic variants. <br />http://simupop.sourceforge.net/cookbook/simurarevariants<br /><br />SUP <br />SLINK/FastSLINK utility program <br />http://mlemire.freeshell.org/software.html<br /><br />TreesimJ <br />A flexible, forward-time population genetic simulator <br />http://code.google.com/p/treesimj/<br /><br />Vortex <br />VORTEX is an individual-based simulation model for population viability analysis (PVA). <br />http://www.vortex9.org/vortex.html<br /><br />References:</p><p>Image www.evolution-of-life.com</p><p>www.cancer.gov</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34443/opera-an-optimal-genome-scaffolding-program</guid>
	<pubDate>Mon, 27 Nov 2017 10:18:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34443/opera-an-optimal-genome-scaffolding-program</link>
	<title><![CDATA[Opera: An optimal genome scaffolding program]]></title>
	<description><![CDATA[<p><span>Opera (Optimal Paired-End Read Assembler) is a sequence assembly program (</span><a href="http://en.wikipedia.org/wiki/Sequence_assembly" target="_blank">http://en.wikipedia.org/wiki/Sequence_assembly&nbsp;<img src="https://a.fsdn.com/con/img/icons/external_asset.png" alt="image" style="border: 0px;"></a><span>). It uses information from paired-end or long reads to optimally order and orient contigs assembled from shotgun-sequencing reads.</span><br><br><span>An updated version called OPERA-LG has been re-engineered with features for the assembly of large and complex genomes.</span><br><br><span>Song Gao, Denis Bertrand, Burton K. H. Chia and Niranjan Nagarajan. OPERA-LG: efficient and exact scaffolding of large, repeat-rich eukaryotic genomes with performance guarantees. Genome Biology, May 2016, doi: 10.1186/s13059-016-0951-y.</span><br><br><span>Song Gao, Wing-Kin Sung, Niranjan Nagarajan. Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences. Journal of Computational Biology, Sept. 2011, doi:10.1089/cmb.2011.0170.</span></p>
<p><span>https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0951-y</span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/operasf/" rel="nofollow">https://sourceforge.net/projects/operasf/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</guid>
	<pubDate>Mon, 04 Dec 2017 10:09:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</link>
	<title><![CDATA[Bandage: interactive visualization of de novo genome assemblies]]></title>
	<description><![CDATA[<p>Bandage (a Bioinformatics Application for Navigating&nbsp;<em>De&nbsp;novo</em>&nbsp;Assembly Graphs Easily) is a tool for visualizing assembly graphs with connections. Users can zoom in to specific areas of the graph and interact with it by moving nodes, adding labels, changing colors and extracting sequences. BLAST searches can be performed within the Bandage graphical user interface and the hits are displayed as highlights in the graph. By displaying connections between contigs, Bandage presents new possibilities for analyzing&nbsp;<em>de novo</em>&nbsp;assemblies that are not possible through investigation of contigs alone.</p>
<p><strong>Availability and implementation:</strong>&nbsp;Source code and binaries are freely available at&nbsp;<a href="https://github.com/rrwick/Bandage" target="pmc_ext">https://github.com/rrwick/Bandage</a>. Bandage is implemented in C++ and supported on Linux, OS X and Windows. A full feature list and screenshots are available at&nbsp;<a href="http://rrwick.github.io/Bandage" target="pmc_ext">http://rrwick.github.io/Bandage</a>.</p><p>Address of the bookmark: <a href="http://rrwick.github.io/Bandage/" rel="nofollow">http://rrwick.github.io/Bandage/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</guid>
	<pubDate>Wed, 10 Jan 2018 07:08:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</link>
	<title><![CDATA[AliTV—interactive visualization of whole genome comparisons]]></title>
	<description><![CDATA[<p>AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at&nbsp;<a href="https://github.com/AliTVTeam/AliTV">https://github.com/AliTVTeam/AliTV</a></p>
<p>https://alitvteam.github.io/AliTV/</p><p>Address of the bookmark: <a href="https://github.com/AliTVTeam/AliTV" rel="nofollow">https://github.com/AliTVTeam/AliTV</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>