We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Current research interests include next-generation DNA sequencing, structural variation, genome rearrangements in cancer and evolution, and network analysis of somatic mutations in cancer. Earlier research included topics in comparative genomics, multiple sequence alignment, and motif finding.

More athttp://compbio.cs.brown.edu/

More at http://biorg.cis.fiu.edu/

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

Rajiv Gandhi Centre for Biotechnology (RGCB) invites applications for the following three faculty scientist positions:

Scientist E-II or F in Bioinformatics & Computational Biology

SCIENTIST E-II OR F IN COMPUTATIONAL BIOLOGY & BIOINFORMATICS

Highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to ongoing research programs in disease biology, provide assistance to analyze complex data sets generated by RGCB scientists and collaborators inclusive of including high dimensional “omics” data and next generation sequencing data, such as whole genome, exome, RNA-seq and ChIP-seq as well as provide leadership for high quality training for junior scientists and regular teaching programs of the institute. Areas of research of interest to RGCB include but are not limited to computational, systems, or quantitative biology with applications to cell biology, developmental biology, metabolism, genomics, proteomics, biophysics, biological information systems, network pharmacology, drug design and cancer research. The scientist’s responsibilities include efforts for the integration of DNA variant annotation with statistical genetic analysis methods including linkage, imputation and association methods, adopting novel and innovative methodologies to analyze, integrate and interpret high dimensional data sets, provision of annotation to robust genetics and genomics findings using several data sources and methods, data management of exploratory clinical and R&D studies in partnership with other lines of genetic data generated from internal and external studies, delivery and documentation of genomic information to support genetic studies, ensuring high-quality genetic and genomic data is incorporated into exploratory- clinical research programs, developing tools that make maximum use of multiple data sources to support annotation of DNA variation and contributes to systems biology initiatives within RGCB

More at http://rgcb.res.in/scientist-positions/

Application Form http://rgcb.res.in/wp-content/uploads/2015/11/APPLICATION-FORMAT-FOR-SCIENTISTS.docx

More at http://www.tiehh.ttu.edu/dr.-kamaleshwar-singh.html