<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26309?offset=1010</link>
	<atom:link href="https://bioinformaticsonline.com/related/26309?offset=1010" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</guid>
	<pubDate>Sat, 12 Oct 2013 18:33:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5462/showreel-2008-cortical-studios</link>
	<title><![CDATA[Showreel 2008 - Cortical Studios]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/qrReqMKe7Xg" frameborder="0" allowfullscreen></iframe>We are a bioinformatics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecular cellbiology and our computer expertise we provide cutting edge 3D animation productions for even the most complex projects. We translate complex scientific information into comprehensible artistic imagery in order to improve communication in the life sciences. Please feel free to contact us with any questions regarding the possibilities for your unique project.

Cortical Studios
Keizersgracht 8
1015 CN
Amsterdam
The Netherlands
info@corticalstudios.nl
www.corticalstudios.nl]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4947/experimental-scientific-officer-bioinformatics</guid>
  <pubDate>Fri, 27 Sep 2013 11:09:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Experimental Scientific Officer (Bioinformatics)]]></title>
  <description><![CDATA[
<p>Closing Date:  8 October 2013</p>

<p>Salary:   £27,854 - £29,541, with progression to £36,298</p>

<p>You will perform cutting edge computational biology within the Faculty of Medical Sciences, with a particular focus on the Northern Institute for Cancer Research (NICR), and contribute to the delivery of Faculty wide programmes of training, analytical services and skill transfer between Faculty Institutes.</p>

<p>You will have a relevant first degree or equivalent qualifications and/or experience in a relevant scientific/technical role, together with previous specialist experience at a senior level in bioinformatics. A PhD is desirable.</p>

<p>This position is part of the Bioinformatics Support Unit but physically located for the majority of the time in the NICR buildings.</p>

<p>Tenable for three years.</p>

<p>Informal enquiries to unit head Dr Simon Cockell: 0191 222 7253; simon.cockell@ncl.ac.uk</p>

<p>For more information visit @ https://www15.i-grasp.com/fe/tpl_newcastle02.asp?s=4A515F4E5A565B1A&amp;jobid=50667,2552984041&amp;key=70203469&amp;c=725434237887&amp;pagestamp=sepghtjhowdqpsxuyn</p>

<p>You can also find several other jobs @http://bsu.ncl.ac.uk/support/recruitment/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</guid>
	<pubDate>Thu, 10 Oct 2019 22:12:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</link>
	<title><![CDATA[Naegleria fowleri: brain eating amoebae]]></title>
	<description><![CDATA[<div><em>Naegleria fowleri</em>&nbsp;is a free living, universally distributed amoeba, which is mostly found in natural, stagnant, warm water bodies such as ponds, lakes, etc. It is also reported to be present even in indoor water bodies, such as swimming pools within a temperature range of 40&ndash;45&deg;C.&nbsp;</div><div>&nbsp;</div><div><img src="https://d.newsweek.com/en/full/351971/naegleria-fowleri.jpg" alt="image" width="720" height="634" style="border: 0px; border: 0px;">&nbsp;</div><div><em style="font-size: 12.8px;">N. fowleri</em>&nbsp;infects the central nervous system of human body by entering through the nose during swimming and outdoor baths in natural stagnant water bodies, leading to meningoencephalitis. It is a condition of inflammation of cerebral tissues and membranes of the brain and is mostly fatal in nature. Casualties due to N. fowleri infections are reported all across the globe including a few in India but only seven survivors in the entire world have been reported till 2015.</div><div>&nbsp;</div><div>You can find two genome assembly at&nbsp;</div><div><a href="https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri">https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri</a></div><div>&nbsp;</div><div>More at&nbsp;<a href="https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri">https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri</a></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5663/network-analysis-indian-statistical-institute</guid>
  <pubDate>Wed, 16 Oct 2013 08:06:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[Network Analysis @ Indian Statistical Institute]]></title>
  <description><![CDATA[
<p>Indian Statistical Institute Kolkata invites applications for the following posts</p>

<p>2013 Oct Advertisement from Indian Statistical Institute</p>

<p>Post: Network Analysis</p>

<p>No. of Positions:  01</p>

<p>Educational Qualifications:</p>

<p>Candidate should have passed BE/B.Tech Or Equivalent in Computer Science / Electrical Engineering / Electronics / Information Technology / Bioinformatics / Biotechnology with throughout first Class<br />Experience:</p>

<p>(details of experience required)<br />Pay Scale: INR Rs.16000-20000/-P.M.</p>

<p>Walk-In-Interview : 22 Oct 2013 at 10:30 AM</p>

<p>Download Official Notification:<br />http://www.isical.ac.in/JobApplicationFiles/MIU_0310201311433700.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/42158/rgcb-recruitment-notification-for-bioinformatician</guid>
  <pubDate>Tue, 25 Aug 2020 00:25:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[RGCB recruitment notification for bioinformatician !]]></title>
  <description><![CDATA[
<p>RGCB Jobs 2020: RGCB released the recruitment notification to hire the candidates who completed B.Tech, M.Sc for 01 Bioinformatician Posts. The eligible candidates can apply for the post through online from 22-08-2020 to 08-09-2020. These selected candidates will be placed as Bioinformatician in Kerala. To know more details such as salary (pay scale), age limit, application fee, application process and more for RGCB recruitment 2020 by clicking apply button.<br />Organization Name : Rajiv Gandhi Centre for Biotechnology<br />Post Name : Bioinformatician<br />No of Vacancy : 01 Posts<br />Salary : Rs.22,000 (Per Month)<br />Last Date to Apply : 08-09-2020</p>

<p>More at https://rgcb.res.in/jobs.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42468/applied-computational-genomics-course-at-uu-spring-2020</guid>
	<pubDate>Wed, 23 Dec 2020 03:30:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42468/applied-computational-genomics-course-at-uu-spring-2020</link>
	<title><![CDATA[Applied Computational Genomics Course at UU: Spring 2020]]></title>
	<description><![CDATA[<p><span>This course will provide a comprehensive introduction to fundamental concepts and experimental approaches in the analysis and interpretation of experimental genomics data. It will be structured as a series of lectures covering key concepts and analytical strategies. A diverse range of biological questions enabled by modern DNA sequencing technologies will be explored including sequence alignment, the identification of genetic variation, structural variation, and ChIP-seq and RNA-seq analysis. Students will learn and apply the fundamental data formats and analysis strategies that underlie computational genomics research.<span>&nbsp;</span></span><strong>The primary goal of the course is for students to be grounded in theory and leave the course empowered to conduct independent genomic analyses.</strong></p><p>Address of the bookmark: <a href="https://github.com/quinlan-lab/applied-computational-genomics" rel="nofollow">https://github.com/quinlan-lab/applied-computational-genomics</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43243/interactive-bioinformatics-resources</guid>
	<pubDate>Thu, 12 Aug 2021 00:09:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43243/interactive-bioinformatics-resources</link>
	<title><![CDATA[Interactive Bioinformatics Resources !]]></title>
	<description><![CDATA[<p>Learn how to use bioinformatics tools right from your browser.<br>Everything runs in a sandbox, so you can experiment all you want.</p>
<p>More at sandbox.bio</p><p>Address of the bookmark: <a href="http://sandbox.bio" rel="nofollow">http://sandbox.bio</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</guid>
	<pubDate>Sat, 18 Mar 2023 11:26:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44279/bioinformatics-training-material</link>
	<title><![CDATA[Bioinformatics Training Material !]]></title>
	<description><![CDATA[<p><span>Glittr</span>&nbsp;is a curated list of bioinformatics training material.<br>All material is:</p>
<ul>
<li>In a GitHub or GitLab repository</li>
<li>Free to use</li>
<li>Written in markdown or similar</li>
</ul>
<p><span>NOTE:</span>&nbsp;This list of courses is selected only based on the above criteria.<br>There are no checks on quality.</p>
<p>https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</p><p>Address of the bookmark: <a href="https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc" rel="nofollow">https://glittr.org/?per_page=25&amp;sort_by=stargazers&amp;sort_direction=desc</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>