<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26309?offset=1350</link>
	<atom:link href="https://bioinformaticsonline.com/related/26309?offset=1350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</guid>
	<pubDate>Sun, 13 Jan 2019 07:14:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</link>
	<title><![CDATA[LTR_retriever: accurately identifies and annotates LTR retrotransposons and use LAI to evaluates the continuity of genome assemblies.]]></title>
	<description><![CDATA[<p>LTR_retriever is a command line program (in Perl) for accurate identification of LTR retrotransposons (LTR-RTs) from outputs of LTRharvest, LTR_FINDER, and/or MGEScan-LTR and generating non-redundant LTR-RT library for genome annotations.</p>
<p>By default, the program will generate whole-genome LTR-RT annotation and the LTR Assembly Index (LAI) for evaluations of the assembly continuity of the input genome. Users can also run LAI separately (see&nbsp;<code>Usage</code>).</p><p>Address of the bookmark: <a href="https://github.com/oushujun/LTR_retriever" rel="nofollow">https://github.com/oushujun/LTR_retriever</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/10739/science-for-life-laboratory-scilifelab-sweden</guid>
  <pubDate>Sat, 10 May 2014 06:22:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Science for Life Laboratory (SciLifeLab)-Sweden]]></title>
  <description><![CDATA[
<p>Science for Life Laboratory (SciLifeLab) is a national center for molecular biosciences with focus on health and environmental research. The center combines frontline technical expertise with advanced knowledge of translational medicine and molecular bioscience. SciLifeLab is a national resource and a collaboration between four universities: Karolinska Institutet, KTH Royal Institute of Technology, Stockholm University and Uppsala University.</p>

<p>Webpage : https://www.scilifelab.se/about-us/<br />Opportunity: https://www.scilifelab.se/about-us/career/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41144/seqmule-automated-human-exomegenome-variants-detection</guid>
	<pubDate>Tue, 18 Feb 2020 03:22:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41144/seqmule-automated-human-exomegenome-variants-detection</link>
	<title><![CDATA[SeqMule: Automated human exome/genome variants detection]]></title>
	<description><![CDATA[<p>SeqMule takes single-end or paird-end FASTQ or BAM files, generates a script consisting of more than 10 popular alignment, analysis tools and runs the script line by line. Users can change the pipeline or fine-tune the parameters by modifying its configuration file.</p><p>Address of the bookmark: <a href="https://doc-openbio.readthedocs.io/projects/seqmule/en/latest/" rel="nofollow">https://doc-openbio.readthedocs.io/projects/seqmule/en/latest/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41896/kad-assessing-genome-assemblies-using-k-mer-copies-in-assemblies-and-k-mer-abundance-in-illumina-reads</guid>
	<pubDate>Fri, 19 Jun 2020 07:34:12 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41896/kad-assessing-genome-assemblies-using-k-mer-copies-in-assemblies-and-k-mer-abundance-in-illumina-reads</link>
	<title><![CDATA[KAD: Assessing genome assemblies using K-mer copies in assemblies and K-mer abundance in Illumina reads]]></title>
	<description><![CDATA[<p>KAD is designed for evaluating the accuracy of nucleotide base quality of genome assemblies. Briefly, abundance of k-mers are quantified for both sequencing reads and assembly sequences. Comparison of the two values results in a single value per k-mer, K-mer Abundance Difference (KAD), which indicates how well the assembly matches read data for each k-mer.</p>
<p><a href="https://render.githubusercontent.com/render/math?math=KAD=log_{2}\begin{pmatrix}\frac{c%2Bm}{m(n%2B1)}\end{pmatrix}" target="_blank"><img src="https://render.githubusercontent.com/render/math?math=KAD=log_{2}\begin{pmatrix}\frac{c%2Bm}{m(n%2B1)}\end{pmatrix}" alt="image" style="border: 0px;"></a></p>
<p>where,&nbsp;<em>c</em>&nbsp;is the count of a k-mer from reads,&nbsp;<em>m</em>&nbsp;is the mode of counts of read k-mers, and&nbsp;<em>n</em>&nbsp;is the copy of the k-mer in the assembly.</p><p>Address of the bookmark: <a href="https://github.com/liu3zhenlab/KAD" rel="nofollow">https://github.com/liu3zhenlab/KAD</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/11107/the-minerva-research-group-for-bioinformatics</guid>
  <pubDate>Tue, 27 May 2014 15:48:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Minerva Research Group for Bioinformatics]]></title>
  <description><![CDATA[
<p>The focus of the bioinformatics group is to use computational approaches to gain an insight into genome evolution in primates.</p>

<p>http://www.eva.mpg.de/genetics/bioinformatics/overview.html?Fsize=0%2C%20%40%2F%27</p>

<p>Kelso Group<br />Department of Evolutionary Genetics<br />Max Planck Institute for Evolutionary Anthropology<br />Deutscher Platz 6<br />04103 Leipzig<br />Germany<br />Phone: +49 341 3550 500</p>

<p>Job: <br />http://www.eva.mpg.de/genetics/bioinformatics/jobs.html?Fsize=0%2C%2B%40</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42936/ancient-whole-genome-duplication-wgd-detection-tools</guid>
	<pubDate>Sun, 07 Mar 2021 00:32:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42936/ancient-whole-genome-duplication-wgd-detection-tools</link>
	<title><![CDATA[Ancient whole genome duplication (WGD) detection tools !]]></title>
	<description><![CDATA[<p>There are two methods for ancient WGD detection, one is collinearity analysis, and the other is based on the Ks distribution map. Among them, Ks is defined as the average number of synonymous substitutions at each synonymous site, and there is also a Ka corresponding to it, which refers to the average number of non-synonymous substitutions at each non-synonymous site.</p><p>At present, some people have posted articles about the analysis process of WGD. I searched for the keyword "wgd pipeline" and found the following:</p><p><strong>GenoDup: https:// github.com/MaoYafei/GenoDup-Pipeline</strong><br /><strong>https://peerj.com/articles/6303/</strong><br /><strong>WGDdetector: https:// github.com/yongzhiyang2 012/WGDdetector</strong><br /><strong>https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2670-3</strong><br /><strong>wgd: https:// github.com/arzwa/wgd</strong><br /><strong>https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2#Sec1</strong><br /><strong>https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x</strong><br /><strong>GeNoGAP https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2</strong><br /><strong>https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x</strong><br /><strong>https://github.com/dfguan/purge_dups</strong><br /><strong>https://www.biorxiv.org/content/10.1101/2020.01.24.917997v1</strong></p><p>This article introduces the usage of wgd.</p><p>Wgd cannot be installed directly with bioconda at present, so it is a little troublesome to install, because it depends on a lot of software. wgd depends on the following software</p><p><strong>BLAST</strong><br /><strong>MCL</strong><br /><strong>MUSCLE/MAFFT/PRANK</strong><br /><strong>PAML</strong><br /><strong>PhyML/FastTree</strong><br /><strong>i-ADHoRe</strong></p><p>But the good news is that most of the software it depends on can be installed with bioconda</p><blockquote><p>conda create -n wgd python=3.5 blast mcl muscle mafft prank paml fasttree cmake libpng mpi=1.0=mpich<br />conda activate wgd</p></blockquote><p>Here mpi=1.0=mpich is selected, because i-adhore depends on mpich. If openmpi is installed, an error will appear while loading shared libraries: libmpi_cxx.so.40: cannot open shared object file: No such file or directory</p><p>After that, the installation is much simpler</p><blockquote><p>git clone https://github.com/arzwa/wgd.git<br />cd wgd<br />pip install .<br />pip install git+https://github.com/arzwa/wgd.git<br />For i-ADHoRe, you need to register at http:// bioinformatics.psb.ugent.be /webtools/i-adhore/licensing/Agree to the license to download i-ADHoRe-3.0</p></blockquote><p>Since my miniconda3 installed ~/opt/, the installation path is so~/opt/miniconda3/envs/wgd/</p><blockquote><p>tar -zxvf i-adhore-3.0.01.tar.gz<br />cd i-adhore-3.0.01<br />mkdir -p build &amp;&amp; cd build<br />cmake .. -DCMAKE_INSTALL_PREFIX=~/opt/miniconda3/envs/wgd/<br />make -j 4 <br />make insatall</p></blockquote><p>Take the sugarcane genome Saccharum spontaneum L as an example. The genome is 8-ploid with 32 chromosomes (2n = 4x8 = 32)</p><p><strong>Download the tutorial for CDS and GFF annotation files</strong></p><blockquote><p><strong>mkdir -p wgd_tutorial &amp;&amp; cd wgd_tutorial</strong><br /><strong>wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.cds.fasta.gz</strong><br /><strong>wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.gff3.gz</strong><br /><strong>gunzip *.gz</strong></p></blockquote><p>First conda activate wgdstart our analysis environment, and then start the analysis</p><p>Step 1 : Use to wgd mclidentify homologous genes in the genome</p><blockquote><p>wgd mcl -n 20 --cds --mcl -s Sspon.v20190103.cds.fasta -o Sspon_cds.out</p></blockquote><p>Step 2 : Use to wgd ksdbuild Ks distribution</p><blockquote><p>wgd ksd --n_threads 80 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl Sspon.v20190103.cds.fasta</p></blockquote><p>Step 3 : If the quality of the genome is good, then wgd syncollinearity analysis can be used . It can help us find the collinearity block in the genome and the corresponding anchor point</p><blockquote><p>wgd syn --feature gene --gene_attribute ID \<br /> -ks wgd_ksd/Sspon.v20190103.cds.fasta.ks.tsv \<br /> Sspon.v20190103.gff3 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl</p></blockquote><p>&nbsp;For more reading - There are 9 sub-modules in WGD</p><ul>
<li><span>kde: KDE fitting to the Ks distribution</span></li>
<li><span>ksd: Ks distribution construction</span></li>
<li><span>mcl: BLASP comparison of All-vs-ALl + MCL classification analysis.</span></li>
<li><span><span>mix: Hybrid modeling of Ks distribution.</span></span></li>
<li><span>pre: preprocess the CDS file</span></li>
<li><span>syn: Call I-ADHoRe 3.0 to use GFF files for collinearity analysis</span></li>
<li><span>viz: draw histogram and density plot</span></li>
<li><span>wf1: Ks standard analysis procedure of the whole genome paranome (paranome), call mcl, ksd and syn</span></li>
<li><span>wf2: Ks standard analysis procedure of one-vs-one homologous gene (ortholog), call wcl and kSD</span></li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>