<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26309?offset=1540</link>
	<atom:link href="https://bioinformaticsonline.com/related/26309?offset=1540" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</guid>
	<pubDate>Tue, 08 May 2018 04:52:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36516/metassembler-merging-and-optimizing-de-novo-genome-assemblies</link>
	<title><![CDATA[Metassembler: merging and optimizing de novo genome assemblies]]></title>
	<description><![CDATA[<p><span>Metassembler combines multiple whole genome de novo assemblies into a combined consensus assembly using the best segments of the individual assemblies.</span></p>
<p><span><span>Genome assembly projects typically run multiple algorithms in an attempt to find the single best assembly, although those assemblies often have complementary, if untapped, strengths and weaknesses. We present our metassembler algorithm that merges multiple assemblies of a genome into a single superior sequence.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/metassembler/?source=directory" rel="nofollow">https://sourceforge.net/projects/metassembler/?source=directory</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/10749/memories-can-be-passed-down-through-dna</guid>
	<pubDate>Sat, 10 May 2014 21:24:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/10749/memories-can-be-passed-down-through-dna</link>
	<title><![CDATA[Memories Can Be Passed Down Through DNA]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/tbPwzII_g6o" frameborder="0" allowfullscreen></iframe>The premise of Assassin's Creed is the reliving of other people's memories stored inside DNA. Well scientists have found that in mice, it actually happens! Anthony is joined by special guest and our friend Tara Long from Hard Science to explain how this process works, and if it might apply to humans as well.

Read More: 
Parental olfactory experience influences behavior and neural structure in subsequent generations
http://www.nature.com/neuro/journal/vaop/ncurrent/abs/nn.3594.html
"Using olfactory molecular specificity, we examined the inheritance of parental traumatic exposure, a phenomenon that has been frequently observed, but not understood."

What Is Epigenetics?
http://www.sciencemag.org/content/330/6004/611
"The cells in a multicellular organism have nominally identical DNA sequences (and therefore the same genetic instruction sets), yet maintain different terminal phenotypes. This nongenetic cellular memory, which records developmental and environmental cues (and alternative cell states in unicellular organisms), is the basis of epi-(above)-genetics."

Epigenetics
http://en.wikipedia.org/wiki/Epigenetics

Watch More:
How to Change Your Genes
https://www.youtube.com/watch?v=B5DU9lgbsSE
TestTube Wild Card
http://testtube.com/dnews/dnews-231-how-too-many-screens-affect-our-brain?utm_source=YT&utm_medium=DNews&utm_campaign=DNWC
Is Sexiness Hereditary?
https://www.youtube.com/watch?v=z6STRCncvM8
____________________

DNews is dedicated to satisfying your curiosity and to bringing you mind-bending stories & perspectives you won't find anywhere else! New videos twice daily. 

Watch More DNews on TestTube http://testtube.com/dnews

Subscribe now! http://www.youtube.com/subscription_center?add_user=dnewschannel

DNews on Twitter http://twitter.com/dnews

Anthony Carboni on Twitter http://twitter.com/acarboni

Laci Green on Twitter http://twitter.com/gogreen18

Trace Dominguez on Twitter http://twitter.com/trace501

DNews on Facebook http://facebook.com/dnews

DNews on Google+ http://gplus.to/dnews

Discovery News http://discoverynews.com]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</guid>
	<pubDate>Sun, 13 Jan 2019 07:05:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</link>
	<title><![CDATA[LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.]]></title>
	<description><![CDATA[<p>LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.</p>
<p>The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE,&nbsp;<a href="http://www.expasy.org/prosite/">http://www.expasy.org/prosite/</a>) to locate cores of important enzymes if they occur.</p><p>Address of the bookmark: <a href="https://github.com/xzhub/LTR_Finder" rel="nofollow">https://github.com/xzhub/LTR_Finder</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/12943/a-history-of-bioinformatics-in-the-year-2039</guid>
	<pubDate>Wed, 23 Jul 2014 06:37:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/12943/a-history-of-bioinformatics-in-the-year-2039</link>
	<title><![CDATA[A History of Bioinformatics (in the Year 2039)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/uwsjwMO-TEA" frameborder="0" allowfullscreen></iframe><p>C. Titus Brown http://video.open-bio.org/video/1/a-history-of-bioinformatics-in-the-year-2039</p>]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</guid>
	<pubDate>Thu, 19 Dec 2019 11:22:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</link>
	<title><![CDATA[5700 year-old human genome !]]></title>
	<description><![CDATA[<p>A Landmark in genomics, scientists have done something that hasn't been done ever.</p><p>Scientists have reconstructed the genome of an ancient human who lived nearly 5,700 years ago in Southern Denmark from the birch pitch- an ancient tar-like substance.</p><p>By sequencing the sample, researchers not only discovered the ancient human DNA but also microbial DNA reflecting the oral microbiome of the person who chewed the pitch, along with plant and animal DNA that could be the recent<span> meal she might have consumed.</span></p><p><span style="font-size: 12.8px;">The DNA sample is comparable in quality to well-preserved teeth and skull bones. The DNA suggests that the chewer was a female, most likely with dark skin, dark brown hair and blue eyes.</span></p><div><p><a href="https://www.nature.com/articles/s41467-019-13549-9?fbclid=IwAR0FPk0Cl25YjHVdcfK4tqFhCsPx00SCSMUwlU6zNwMDNrKi1QynwtJKDfE" target="_blank">https://www.nature.com/articles/s41467-019-13549-9</a></p><p><img src="https://i.kinja-img.com/gawker-media/image/upload/c_scale,f_auto,fl_progressive,q_80,w_800/ykcvh491evenyvlrjb9r.jpg" width="800" height="450" alt="image" style="border: 0px;"></p><p>Artistic reconstruction. (Tom Bj&ouml;rklund)</p><p>More at&nbsp;<a href="https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633">https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633</a></p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>