Chettinad Academy of Research and Education (CARE) invites applications from eligible and translational research-oriented candidates to the posts of Professor/Associate Professor/ Assistant Professor Computational Biology, Bioinformatics, and Pharmaceutical Chemistry.

Emoluments: As per UGC norms (Adequate Compensation for Postdoctoral/Teaching experience)

Candidates fulfilling the eligibility criteria as per the UGC norms can send their full CV with copies of certificates and reference letters to the following address by post or by e-mail on or before 31st May 2014

The Registrar,
Chettinad Academy of Research and Education,
Chettinad Health City
Kelambakkam, Chennai 603 103
Tamil Nadu
T +91 (0)44 4741 1000
F +91 (0)44 4741 1011
Email: jobs @chettinadhealthcity.com

Advertisement: http://182.73.176.163/chc/ads2014.pdf

http://lin-group.cn/server/iRNAD/

Address of the bookmark: http://lin-group.cn/server/iRNAD/

Address of the bookmark: http://huanglab.phys.hust.edu.cn/hnadock/

Tasks:  239 total,   1 running,  238 sleeping,   0 stopped,   0 zombie

This line tells you how many processes are running. If you are using laptops machines it’s not so interesting because you really are the only one using this machine.

Cpu(s):  0.0%us,  0.0%sy,  0.0%ni,100.0%id,  0.0%wa,  0.0%hi,  0.0%si,  0.0%st

This line contains the CPU load. The first two numbers are how busy the system is doing computation (“us” stands for “user”) and how busy the system is doing system-y things like accessing disks or network (“sy” stands for “system”). We’ll talk more about this later.

Mem:   49457320k total,    3492174k used,  14535596k free,    1435148k buffers

This should be easy to understand – how much memory you’re using!

Swap:   539356k total,   28332k used,   836562k free,    29862014k cached

Swap is just on-disk memory that can be used to “swap” out programs from main memory. Again, we’ll talk about this later.:

PID USER      PR  NI  VIRT  RES  SHR S %CPU %MEM    TIME+  COMMAND
  1 root      39   19  0  0  0 S  0.0  0.0   246:57.22 kipmi0
  2 root      RT   0     0    0    0 S  0.0  0.0   0:00.00 migration/0

And... finally! What’s actually running! The two most important numbers are the %CPU and %MEM towards the right, as well as the COMMAND. This tells you how compute- and memory-intensive your program is. Right now, nothing’s running so the numbers aren’t very interesting, but just wait until we run something...

CPAT - https://github.com/liguowang/cpat, http://lilab.research.bcm.edu/ (web server)

CPC2 - https://github.com/gao-lab/CPC2_standalone, http://cpc2.gao-lab.org/ (web server)

Infernal - http://eddylab.org/infernal/, https://github.com/EddyRivasLab/infernal

NCBI RefSeq - https://www.ncbi.nlm.nih.gov/refseq/

Rfam - http://rfam.xfam.org/, https://docs.rfam.org/en/latest/index.html

SILVA - https://www.arb-silva.de/

RNAmmer - http://www.cbs.dtu.dk/services/RNAmmer/ (web server, standalone download link)

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Assistant Professor in Bioinformatics

Essential :
First Class Master’s Degree in the appropriate branch of Life Sciences / Technology (Tech.)
OR
Ph.D in Life Sciences or in the respective subject area of specialization
OR
Good Academic record with at least 55% marks (or an equivalent grade) at the Master’s Degree level, in the relevant subject or an equivalent degree from an Indian / Foreign University.
Besides fulfilling the above qualifications, candidates should have cleared the eligibility test (NET) for lecturers conducted by the UGC, CSIR or similar test accredited by the UGC and as per the requirements of UGC guidelines.

Desirable :
Teaching, research industrial and/or professional experience in a reputed organization.
Papers presented at Conferences and/or in refereed journals

Note : Application are invited in prescribed form Click here for Application Form
Kindly send your applications to “Registrar, Dr. D. Y. Patil Vidyapeeth, Pune, Sant Tukaram Nagar, Pimpri, Pune – 411018., Maharashtra, India.” should reach in the University office within 15 days from the publication.

More Info: http://www.dpu.edu.in/BiotechResearchPositions.aspx

As one of the leading research-intensive universities in China, ZJU is located in the beautiful city of Hangzhou. Successful candidates will be employed as Principal Investigators and are qualified to supervise doctoral students. ZJU will offer an internationally competitive salary and the opportunity to purchase university's apartment at a price much lower than the market price, and will provide office and laboratory spaces as well as internationally competitive research startup packages.

Qualified applicants are strongly encouraged to submit their applications electronically to tr@zju.edu.cn. Applicants should include the following materials in pdf format: a comprehensive CV, a statement of research and teaching plan, and a list of 3 to 5 references with detailed contact information.

Contact：Talents Office, ZJU

Tel：+86-571-88981345, +86-571-88981390

Fax：+86-571-88981976

E-mail:tr@zju.edu.cn