To read the manual, please click the link https://askarbek-orakov.github.io/ASAR/

Address of the bookmark: https://github.com/Askarbek-orakov/ASAR

TMAP is a fast and accurate alignment software for short and long nucleotide sequences produced by next-generation sequencing technologies.

• The latest TMAP is unsupported. To use a supported version, please see the TMAP version associated with a Torrent Suite release below.

• Get the latest source code:

  git clone git://github.com/iontorrent/TMAP.git
   cd TMAP
   git submodule init
   git submodule update

https://github.com/iontorrent/TS/tree/master/Analysis/TMAP

Address of the bookmark: https://github.com/iontorrent/TS/tree/master/Analysis/TMAP

Address of the bookmark: https://github.com/yjx1217/LRSDAY

 All the nodes in the tree are clickable. This displays various information and options:

• The species name (and the associated common name if there is one)
• The rank (kingdom, family, class, species...)
• Ability to go to the corresponding node/species on NCBI web site (displayed in a new window)
• Possibility to download the corresponding subtree in newick extended format
• Possibilty to get the whole lineage from the current node/tip to the root of the tree.

Address of the bookmark: http://lifemap-ncbi.univ-lyon1.fr/

BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.

Address of the bookmark: https://amp.pharm.mssm.edu/biojupies/

Date: April 24th. 2017 Last Date: May 6th 2017
PROJECT ID: 632

The following posts are urgently required to be filled for the Department of Biotechnology, Government of India funded project jointly running with IIIT-Hyderabad & JNU, entitled "Computational Core for Plant Metabolomics" administrated by Prof Indira Ghosh, School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067.
NB: For all the posts, preference will be given to candidates with a good knowledge of Python and/or R in UNIX platform , knowledge of JAVA will also get a special consideration.

1. RA / Research Associate (Metabolic engineering/Computational Biologist)

Salary: Rs. 36000/- + HRA

Vacancy: 1

Essential Qualifications: PhD in Bioinformatics /Mathematics/Computer Science with experience in analyzing high throughput omics-based data/Analysis of Network Biology/Chemoinformatics/Computational Biology related Software development. Published paper in the field is a must to prove the experience. Special consideration will be given if have experience in Industry, teaching & product development.

Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, planning of new research area in metabolic driven network , collaborating with industry , preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.

2. Project SRF (Network model building/Systems biology integration)

Salary*: Rs.18000/- + HRA

Vacancy: 1

Essential Qualifications: M.Tech in Computational Biology with project experience or Masters / B.Tech in Basic Sciences with at least 2yrs of research experience in Bioinformatics/Mathematical Model building using Computational Biology tools & related Database / Network analysis etc. For M.Sc/B.Tech, Published paper in peer-reviewed Journal whereas for M.Tech, the degree obtained in computational biology is a must.

Desired Skills: Will be expected to manage ongoing research activities in LIMS, interact with LIMS group, build network model using data compiled by experimentalist, prepare and file reports and associated project work etc. Familiarity with plant systems biology and genomics /metabolite resources related to plant metabolomics is desirable.

More at http://www.jnu.ac.in/Career/currentjobs.htm

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.^[1]

Address of the bookmark: https://en.wikipedia.org/wiki/FASTQ_format

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

https://bienkocrosettolabs.org/