Key Findings:

1. Chromosomal Fusion and Its Molecular Signature:

   • The fusion site is located at 2q13–2q14.1 and is characterized by degenerate telomeric sequences appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.
   • Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.

2. Extensive Duplications in the Surrounding Genomic Region:

   • The study identifies large-scale segmental duplications flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.
   • These duplications are predominantly located in subtelomeric and pericentromeric regions, suggesting their role in genomic instability and chromosomal evolution.

3. Paralogous Regions and Their Evolutionary Relationships:

   • A 168-kilobase (kb) segment near the fusion site has 98%–99% sequence identity with three regions on chromosome 9 (9pter, 9p11.2, and 9q13).
   • Another 67-kb region distal to the fusion site shows a high degree of homology to sequences in chromosome 22qter.
   • Additionally, a 100-kb segment exhibits 96% sequence identity with a region in chromosome 2q11.2.

4. Comparative Genomics and Evolutionary Implications:

   • By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.
   • The presence of specific repetitive elements within these duplicated segments serves as evolutionary markers that help infer their historical rearrangements.
   • Some of these duplicated regions are associated with chromosomal inversion breakpoints, potentially contributing to evolutionary changes in primates.
   • Recurrent structural rearrangements in these regions have been linked to human chromosomal disorders.

Conclusions and Implications:

• The findings provide valuable insights into the structural evolution of human chromosome 2, which played a crucial role in human speciation.
• Understanding these segmental duplications and their evolutionary trajectories sheds light on genomic instability, which may contribute to human genetic diseases.
• The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the evolutionary divergence of humans from other primates.

This research advances our understanding of human genome evolution and offers a foundation for studying the effects of structural variants in genetic disorders.

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

You might learn a lot about that house—the rooms, the doors, the furniture—but you would miss the bigger story: the streets, the neighborhoods, and all the ways the city changes from one place to another.

Something similar happens when scientists study bacterial genomes one at a time.

Over the past decade, researchers have collected thousands of bacterial genomes. These genomes contain an enormous amount of information about how bacteria survive, adapt, and evolve. But comparing thousands of individual genomes can quickly become a computational maze.

That is where PANORAMA enters the story.

Developed by Jérôme Arnoux and colleagues, PANORAMA is a computational tool designed to explore bacterial pangenomes—the complete collection of genetic possibilities found across a species or group of related organisms. Instead of looking at every genome as an isolated object, the approach represents their shared and variable genetic features as a graph.

Think of this graph as a giant subway map.

Some stations appear on almost every route. These represent genes that are highly conserved. Other stations appear only on certain routes, representing genes that some bacteria possess while others do not. By looking at the entire network, scientists can begin to see not just *what genes exist*, but how they are organized and how biological systems are distributed across populations.

The researchers put PANORAMA to the test using 941 genomes of Pseudomonas aeruginosa, a bacterium important in human health. They used the tool to investigate biological systems, including bacterial defense mechanisms against viruses known as bacteriophages. They then expanded the analysis to more than 6,000 genomes from four Enterobacteriaceae species.

The result is more than a faster way to process data.

PANORAMA allows researchers to ask a bigger question: What can an entire microbial species do, genetically speaking?

By comparing pangenomes, the researchers could identify systems shared between species as well as distinctive features. They could also find recurring genomic locations where genetic material is inserted—clues that may reveal common evolutionary processes.

And this is perhaps the most exciting part of the story.

Every bacterial genome is like a page in a huge evolutionary book. Until recently, reading thousands of those pages together was difficult. PANORAMA provides a way to turn those pages into a map, allowing scientists to see patterns that might disappear when each genome is studied separately.

The study, published in PLOS Computational Biology in July 2026, presents PANORAMA as a foundation for large-scale comparative pangenomics. The software and accompanying analysis resources are openly available, giving other researchers the opportunity to explore microbial diversity themselves.

So the story is not really about one bacterium or one genome.

It is about changing the way we look at life.

Instead of asking, “What is inside this genome?”, scientists can increasingly ask, “What is the full genetic landscape of this species—and how did it become this way?”

And sometimes, when you stop looking at one house and finally see the whole city, the most interesting discoveries are hiding in the streets between them.

Read more at https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1013856

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

A recent study by Webster and Chapman introduces Buscogeny (https://github.com/Jwebster89/Buscogeny), an open-source bioinformatics pipeline designed to make this process easier. The tool uses BUSCO (Benchmarking Universal Single-Copy Orthologs), which identifies conserved genes that are expected to occur as single copies in particular groups of organisms. These genes act like evolutionary landmarks, allowing researchers to compare genomes and investigate their relationships.

Buscogeny brings several steps of phylogenomic analysis into one workflow. It identifies BUSCO genes, extracts and aligns their sequences, removes unreliable regions, combines information from multiple genes, and uses the resulting data to construct a phylogenetic tree. It also provides quality-control information, helping researchers identify genomes that may be too incomplete for reliable analysis.

The authors demonstrate the usefulness of Buscogeny with bacterial and fungal genomes, including Alternaria. This is particularly valuable because fungal genomes can vary greatly in quality and annotation. Ultimately, Buscogeny helps transform massive amounts of genomic data into an understandable evolutionary story. Each DNA sequence becomes a clue, each conserved gene becomes a landmark, and together these clues reveal a picture of how life is connected.

More at https://link.springer.com/article/10.1007/s10123-025-00752-6?

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Orthology relations can be used to transfer annotations from one gene (or protein) to another. Hence, detecting orthology relations has become an important task in the post-genomic era. Various genomic events, such as duplication and horizontal gene transfer, can cause erroneous assignment of orthology relations. In closely-related species, gene neighborhood information can be used to resolve many ambiguities in orthology inference. Here we present OrthoGNC, a software for accurately predicting pairwise orthology relations based on gene neighborhood conservation. Analyses on simulated and real data reveal the high accuracy of OrthoGNC. In addition to orthology detection, OrthoGNC can be employed to investigate the conservation of genomic context among potential orthologs detected by other methods. OrthoGNC is freely available online at http://bs.ipm.ir/softwares/orthognc and http://tinyurl.com/orthoGNC.

http://www.comp.nus.edu.sg/~wongls/projects/orthoGNC/

Address of the bookmark: http://www.sciencedirect.com/science/article/pii/S1672022917301663

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

3D-Dock Suite

Global rigid search: FFTShape complementarity and electrostatics

Re-scoring and clustering. Refinement of interface side-chains

3D-Garden

Global rigid search in ensamble

Shape complementarity and Lennard–Jones potential

Side chain and backbone dihedral refinement

DOT

Global rigid search: FFTShape complementarity, electrostatics and VDWNone

Escher NG

Global rigid searchShape complementarity, hydrogen bonds and electrostatic

Integrated in VEGA

GRAMM 

Global rigid search: FFT. smooth protein surface representation for soft docking

Shape complementarity and Lennard-Jones potential

Clustering of conformations

GRAMM-X 

Global rigid search: FFT. smooth protein surface representation for soft docking

Shape complementarity and Lennard-Jones potentialminimization and re-scoring with multiple filters

HEX

Global rigid search: Fourier correlation of spherical harmonics

Shape complementarity

HADDOCK

Global rigid searchElectrostatic ,VDW and desolvation energy termsMD simulated annealing refinement . Filtering based on external data. 

ICM

Global rigid search: Monte CarloEmpirical scoring function

Clustering and selection of conformations. Refinement of interface side-chains and re-scoring

MolFit 

Global rigid search: FFTShape complementarity

Clustering of good solutions, filtering using a priori information and small, local rigid rotations around selected conformations

PatchDock

Global rigid searchShape complementarity and atomic desolvation energy

Clustering of conformations

PyDock

Global rigid search:FFTShape complementarity

rescoring by binding electrostatics and desolvation energy

RosettaDock

Local rigid search: Monte Carlo with low and high resolution structure representation levels

Different scoring parameters for the different resolutions 

ZDOCK

Global rigid search: FFTShape complementarity, desolvation energy, and electrostatics.

Energy minimization and re-scoringFree for academics

Point to note:

The proper treatment of flexibility in protein–protein docking is still an active field of research. You first should analyzed your proteins in order to define their conformational space and then choose the most suitable method for your docking problem.