A recent study by Webster and Chapman introduces Buscogeny (https://github.com/Jwebster89/Buscogeny), an open-source bioinformatics pipeline designed to make this process easier. The tool uses BUSCO (Benchmarking Universal Single-Copy Orthologs), which identifies conserved genes that are expected to occur as single copies in particular groups of organisms. These genes act like evolutionary landmarks, allowing researchers to compare genomes and investigate their relationships.

Buscogeny brings several steps of phylogenomic analysis into one workflow. It identifies BUSCO genes, extracts and aligns their sequences, removes unreliable regions, combines information from multiple genes, and uses the resulting data to construct a phylogenetic tree. It also provides quality-control information, helping researchers identify genomes that may be too incomplete for reliable analysis.

The authors demonstrate the usefulness of Buscogeny with bacterial and fungal genomes, including Alternaria. This is particularly valuable because fungal genomes can vary greatly in quality and annotation. Ultimately, Buscogeny helps transform massive amounts of genomic data into an understandable evolutionary story. Each DNA sequence becomes a clue, each conserved gene becomes a landmark, and together these clues reveal a picture of how life is connected.

More at https://link.springer.com/article/10.1007/s10123-025-00752-6?

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Orthology relations can be used to transfer annotations from one gene (or protein) to another. Hence, detecting orthology relations has become an important task in the post-genomic era. Various genomic events, such as duplication and horizontal gene transfer, can cause erroneous assignment of orthology relations. In closely-related species, gene neighborhood information can be used to resolve many ambiguities in orthology inference. Here we present OrthoGNC, a software for accurately predicting pairwise orthology relations based on gene neighborhood conservation. Analyses on simulated and real data reveal the high accuracy of OrthoGNC. In addition to orthology detection, OrthoGNC can be employed to investigate the conservation of genomic context among potential orthologs detected by other methods. OrthoGNC is freely available online at http://bs.ipm.ir/softwares/orthognc and http://tinyurl.com/orthoGNC.

http://www.comp.nus.edu.sg/~wongls/projects/orthoGNC/

Address of the bookmark: http://www.sciencedirect.com/science/article/pii/S1672022917301663

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

3D-Dock Suite

Global rigid search: FFTShape complementarity and electrostatics

Re-scoring and clustering. Refinement of interface side-chains

3D-Garden

Global rigid search in ensamble

Shape complementarity and Lennard–Jones potential

Side chain and backbone dihedral refinement

DOT

Global rigid search: FFTShape complementarity, electrostatics and VDWNone

Escher NG

Global rigid searchShape complementarity, hydrogen bonds and electrostatic

Integrated in VEGA

GRAMM 

Global rigid search: FFT. smooth protein surface representation for soft docking

Shape complementarity and Lennard-Jones potential

Clustering of conformations

GRAMM-X 

Global rigid search: FFT. smooth protein surface representation for soft docking

Shape complementarity and Lennard-Jones potentialminimization and re-scoring with multiple filters

HEX

Global rigid search: Fourier correlation of spherical harmonics

Shape complementarity

HADDOCK

Global rigid searchElectrostatic ,VDW and desolvation energy termsMD simulated annealing refinement . Filtering based on external data. 

ICM

Global rigid search: Monte CarloEmpirical scoring function

Clustering and selection of conformations. Refinement of interface side-chains and re-scoring

MolFit 

Global rigid search: FFTShape complementarity

Clustering of good solutions, filtering using a priori information and small, local rigid rotations around selected conformations

PatchDock

Global rigid searchShape complementarity and atomic desolvation energy

Clustering of conformations

PyDock

Global rigid search:FFTShape complementarity

rescoring by binding electrostatics and desolvation energy

RosettaDock

Local rigid search: Monte Carlo with low and high resolution structure representation levels

Different scoring parameters for the different resolutions 

ZDOCK

Global rigid search: FFTShape complementarity, desolvation energy, and electrostatics.

Energy minimization and re-scoringFree for academics

Point to note:

The proper treatment of flexibility in protein–protein docking is still an active field of research. You first should analyzed your proteins in order to define their conformational space and then choose the most suitable method for your docking problem.

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://github.com/PapenfussLab/gridss

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

A list of programs for genotype and SNP calling :

SOAP2 http://soap.genomics.org.cn/index.html

Single-sample High-quality variant database (for example, dbSNP) Package for NGS data analysis, which includes a single individual genotype caller (SOAPsnp)

realSFS http://128.32.118.212/thorfinn/realSFS/

Single-sample Aligned reads Software for SNP and genotype calling using single individuals and allele frequencies. Site frequency spectrum (SFS) estimation

Samtools http://samtools.sourceforge.net/

Multi-sample Aligned reads Package for manipulation of NGS alignments, which includes a computation of genotype likelihoods (samtools) and SNP and genotype calling (bcftools)

GATK http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit Multi-sample Aligned reads Package for aligned NGS data analysis, which includes a SNP and genotype caller (Unifed Genotyper), SNP filtering (Variant Filtration) and SNP quality recalibration (Variant Recalibrator)

Beagle http://faculty.washington.edu/browning/beagle/beagle.html

Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation, phasing and association that includes a mode for genotype calling

IMPUTE2 http://mathgen.stats.ox.ac.uk/impute/impute_v2.html

Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation and phasing, including a mode for genotype calling. Requires fine-scale linkage map

QCall ftp://ftp.sanger.ac.uk/pub/rd/QCALL

Multi-sample LD ‘Feasible’ genealogies at a dense set of loci, genotype likelihoods Software for SNP and genotype calling, including a method for generating candidate SNPs without LD information (NLDA) and a method for incorporating LD information (LDA). The ‘feasible’ genealogies can be generated using Margarita (http://www.sanger.ac.uk/resources/software/margarita)

MaCH http://genome.sph.umich.edu/wiki/Thunder

Multi-sample LD Genotype likelihoods Software for SNP and genotype calling, including a method (GPT_Freq) for generating candidate SNPs without LD information and a method (thunder_glf_freq) for incorporating LD information