<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26409?offset=970</link>
	<atom:link href="https://bioinformaticsonline.com/related/26409?offset=970" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38445/orthoani-an-improved-algorithm-and-software-for-calculating-average-nucleotide-identity</guid>
	<pubDate>Wed, 12 Dec 2018 08:36:08 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38445/orthoani-an-improved-algorithm-and-software-for-calculating-average-nucleotide-identity</link>
	<title><![CDATA[OrthoANI: An improved algorithm and software for calculating average nucleotide identity]]></title>
	<description><![CDATA[<p><span>OAT uses OrthoANI to measure the overall similarity between two genome sequences. ANI and OrthoANI are comparable algorithms: they share the same species demarcation cut-off at 95~96% and large comparison studies have demonstrated both algorithms to produce near identical reciprocal similarities. Details of the OrthoANI algorithm is given in (Lee et al. 2015). OAT employs an easy-to-follow Graphical User Interface that allow researchers to calculate OrthoANI values between genomes of interest without unfamiliar Command Line Environments. Moreover, the OAT_cmd command-line software can be integrated into preexisting bioinformatics pipelines.&nbsp;</span></p><p>Address of the bookmark: <a href="https://www.ezbiocloud.net/tools/orthoani" rel="nofollow">https://www.ezbiocloud.net/tools/orthoani</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39200/omtools-a-software-package-for-visualizing-and-processing-optical-mapping-data</guid>
	<pubDate>Fri, 29 Mar 2019 01:21:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39200/omtools-a-software-package-for-visualizing-and-processing-optical-mapping-data</link>
	<title><![CDATA[OMTools: a software package for visualizing and processing optical mapping data]]></title>
	<description><![CDATA[<p><span>OMTools, an efficient and intuitive data processing and visualization suite to handle and explore large-scale optical mapping profiles. OMTools includes modules for visualization (OMView), data processing and simulation. These modules together form an accessible and convenient pipeline for optical mapping analyses.</span></p>
<p><span><a href="https://github.com/TF-Chan-Lab/OMTools">https://github.com/TF-Chan-Lab/OMTools</a></span></p><p>Address of the bookmark: <a href="https://github.com/TF-Chan-Lab/OMTools" rel="nofollow">https://github.com/TF-Chan-Lab/OMTools</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42568/breedbase-is-a-comprehensive-breeding-management-and-analysis-software</guid>
	<pubDate>Wed, 06 Jan 2021 19:45:21 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42568/breedbase-is-a-comprehensive-breeding-management-and-analysis-software</link>
	<title><![CDATA[Breedbase is a comprehensive breeding management and analysis software]]></title>
	<description><![CDATA[<p><span>Breedbase is a comprehensive breeding management and analysis software. It can be used to design field layouts, collect phenotypic information using tablets, support the collection of genotyping samples in a field, store large amounts of high density genotypic information, and provide Genomic Selection related analyses and predictions. Breedbase supports the BrAPI standard.</span></p><p>Address of the bookmark: <a href="https://breedbase.org/" rel="nofollow">https://breedbase.org/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44876/dna2bit-an-ultra-fast-and-accurate-genomic-distance-estimation-software</guid>
	<pubDate>Wed, 13 Aug 2025 19:56:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44876/dna2bit-an-ultra-fast-and-accurate-genomic-distance-estimation-software</link>
	<title><![CDATA[dna2bit: an ultra-fast and accurate genomic distance estimation software]]></title>
	<description><![CDATA[<p dir="auto">dna2bit: an ultra-fast and accurate genomic distance estimation software</p>
<div dir="auto"><a href="https://github.com/lijuzeng/dna2bit#compilation"></a></div>
<p dir="auto">dna2bit is a software tool developed in C++11, leveraging the capabilities of OpenMP for parallel computing and the popcount technique for efficient bit manipulation.&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/lijuzeng/dna2bit" rel="nofollow">https://github.com/lijuzeng/dna2bit</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

</channel>
</rss>