<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26414?offset=1240</link>
	<atom:link href="https://bioinformaticsonline.com/related/26414?offset=1240" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11434/adhoc-bioinformatics-faculty-position-nit</guid>
  <pubDate>Tue, 03 Jun 2014 16:19:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[Adhoc Bioinformatics Faculty Position @ NIT]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, DEPARTMENT OF BIOTECHNOLOGY, WARANGAL – 506 021, Andhra Pradesh</p>

<p>No.NITW/BT/2014/adhoc</p>

<p>APPLICATIONS ARE INVITED FOR THE APPOINTMENT OF ADHOC FACULTY ON CONTRACT BASIS IN THE DEAPARTMENT OF BIOTECHNOLOGY</p>

<p>Period of Contract: Initially the appointment is for one semester i.e., from July 2014 up to December 2014 only.</p>

<p>Essential Qualifications:</p>

<p>i) B. Tech or equivalent in Biotechnology/ Industrial Biotechnology/ Biochemical Engineering / Chemical Engg. Or M. Sc in Microbiology/ Botany/ Zoology/ Biochemistry/Biotechnology and ii) M. Tech or equivalent in Biotechnology/Industrial Biotechnology/Bioinformatics</p>

<p>Or</p>

<p>Integrated M. Tech in Biotechnology/Industrial Biotechnology/ Bioinformatics</p>

<p>Candidates must possess First class (60% aggregate marks or 6.5 CGPA) at B. Tech/ M. Sc and M. Tech.</p>

<p>Desirable: Ph. D Pay Package: All selected candidates shall be eligible for a consolidated pay of Rs.30, 000/- per month. Candidates with Ph. D shall be eligible for an additional amount of Rs.5, 000/- per month.</p>

<p>How to apply : Applications on plain paper with attested photocopies of certificate and bio data along with justification for eligibility should reach to the Head, Department of Biotechnology, National Institute of Technology, Warangal AP 506004 in the form of soft or hard copy on or before 21st June 2014 email : biotech_hod@nitw.ac.in</p>

<p>Intimation: No separate call letters will be sent to the candidates. All the eligible candidates will be notified in the institute web site on 23rd June 2014. All the eligible candidates are requested to report for the interview to the Head, Department of Biotechnology at 9:00 AM on 27th June 2014</p>

<p>Joining: Selected candidates will be informed and they are expected to join immediately.</p>

<p>Advertisement:</p>

<p>http://www.nitw.ac.in/nitw/announcements/2014/Bio-Adhoc%20Advt.%20May-2014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</guid>
	<pubDate>Thu, 12 Jun 2014 17:43:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</link>
	<title><![CDATA[Search Shell Command History]]></title>
	<description><![CDATA[<p>We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it? <br /><br />Now a days almost all modern shell allows you to search command history if enabled by user. Use history command to display the history list with line numbers. Lines listed with with a * have been modified by user.</p><p><br /><strong>Shell history search command</strong><br /><br />Type history at a shell prompt:<br />$ history</p><p>It will display the list of all used commandline history with an serial number.<br /><br />To search particular command, enter:<br />$ history | grep command-name<br />$ history | egrep -i 'scp|ssh|ftp'<br />Emacs Line-Edit Mode Command History Searching<br /><br />To get previous command containing string, hit [CTRL]+[r] followed by search string:<br /><br />(reverse-i-search): <br /><br />To get previous command, hit [CTRL]+[p]. You can also use up arrow key.<br /><br />CTRL-p<br /><br />To get next command, hit [CTRL]+[n]. You can also use down arrow key.<br /><br />CTRL-n<br /><br /></p><p><strong>fc command</strong></p><p>Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.</p><p>For example list last 10 command, enter:<br />$ fc -l 10<br />To list commands 130 through 150, enter:<br />$ fc -l 130 150<br />To list all commands since the last command beginning with ssh, enter:<br />$ fc -l ssh<br />You can edit commands 1 through 5 using vi text editor, enter:<br />$ fc -e vi 1 5</p><p><strong>Delete command history</strong><br /><br />The -c option causes the history list to be cleared by deleting all of the entries:<br />$ history -c</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</guid>
	<pubDate>Sun, 08 Jun 2014 09:56:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</link>
	<title><![CDATA[Bioinformatician’s Pocket Reference !!]]></title>
	<description><![CDATA[<p><span>It is amusing how brain of bioinformaticians work! Learning a new programming language for days feels so much of fun that making 5 minute discussion with neighbours (unless under special circumstances!) in our own mother-tongue. Today every bioinformatician keeps more than few languages and core IT toolkits on their plate. It has become mandatory to be able to mould different code snippets to build our own custom workflows, and thus keeping syntax at our fingertips has become essential.Although Google is best way to get syntax problem solved, it is not a bad idea to keep reference sheets is our smartphones or stick out some printed sheets on the back of your door, in the old fashion way!!</span></p><p>Address of the bookmark: <a href="http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/" rel="nofollow">http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/</a></p>]]></description>
	<dc:creator>RAJESH DETROJA</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12218/assistant-professor-in-medical-bioinformatics</guid>
  <pubDate>Tue, 24 Jun 2014 01:46:36 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor in Medical Bioinformatics]]></title>
  <description><![CDATA[
<p>Advt. No : ME-I/A-IV/03/14<br />No.of Posts:01 (SC)<br />Pay Scale:<br />Pay Band of Rs.15600-39100 + Rs.6000/- GP +NPA @ 25% of Basic Pay +Learning Resource Allowance @ Rs.20,000/-P.A.+ Conveyance Allowance @ Rs. 1650/-P.M.+ Academic Allowance @ Rs.2500/- P.M. and other admissible allowances.<br />Qualifications:<br />Area of Specialization:-<br />Bioinformatics/Computational/Biology/Genomics/ Proteomics/ Structural Biology<br />1. Postgraduate qualification, e.g. Master’s Degree in Biotechnology/Bioinformatics/ Biophysics.<br />2. A Doctorate Degree of recognized University/Institute in a basic or allied Medical Science subject e.g. Medical Biotechnology/Biophysics. Bioinformatics/X-ray Crystallography/<br />Immunology/Structural Biology etc<br />Experience:<br />1.Minimum three years teaching and/or research experience in a recognized medical/research Institution in an allied medical subject after obtaining doctorate degree and preferably in Medical<br />Molecular Biology/ Biophysics/Structural Biology/Genomics and Clinical Proteomics/Computational Biology.<br />2. Minimum two publication with atleast one in international journal and atleast one as first author<br />Desirable:-<br />Consistently excellent scholastic/academic record, demonstrated ability to write grant proposal/(s) successfully, Post Doctoral training in a frontier area of medical Bioinformatics Research and of direct relevance to clinical diagnosis or patient care (preferably from a recognized top-ranking medical institution abroad)<br />Send your applications to O/O, Deputy Registrar, Recruitment &amp; Establishment Cell, University of Health Sciences, Rohtak by 08.7.2014<br />For more details,please visit website: http://pgimsrohtak.nic.in/2014%20AP%20Advt.pdf<br />Last Apply Date: 08 Jul 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12582/postdoc-position-at-centre-mediterraneen-de-medecine-moleculaire</guid>
  <pubDate>Sun, 06 Jul 2014 11:23:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Centre Méditerranéen de Médecine Moléculaire]]></title>
  <description><![CDATA[
<p>The research group of Dr. Michele Trabucchi at the Centre Méditerranéen de Médecine Moléculaire (C3M) at INSERM U1065 (University of Nice Sophia-Antipolis, France) is seeking candidates for a Postdoctoral fellow position to start on October 2014 for 3 years funded by FRM (Fondation pour la Recherche Médicale).<br />The broad interest of the lab is in understanding the expression control and function of small RNAs in activated myeloid cells (visit our webpage to check research interests and publications of the group : http://www.unice.fr/c3m/EN/Equipe10.html ). </p>

<p>The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.<br /> <br />Candidates should hold a Ph.D. degree and have strong background in bioinformatics.<br />The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.<br />Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )</p>
]]></description>
</item>

</channel>
</rss>