<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26424?</link>
	<atom:link href="https://bioinformaticsonline.com/related/26424?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26559/microscope</guid>
	<pubDate>Fri, 04 Mar 2016 05:26:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26559/microscope</link>
	<title><![CDATA[Microscope]]></title>
	<description><![CDATA[<p>Microscope Platform user documentation.</p>
<p>The MicroScope platform is available at this URL:</p>
<p><a href="https://www.genoscope.cns.fr/agc/microscope">https://www.genoscope.cns.fr/agc/microscope</a></p><p>Address of the bookmark: <a href="http://microscope.readthedocs.org/en/latest/index.html" rel="nofollow">http://microscope.readthedocs.org/en/latest/index.html</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26414/advanced-bash-scripting-guide</guid>
	<pubDate>Thu, 18 Feb 2016 04:50:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26414/advanced-bash-scripting-guide</link>
	<title><![CDATA[Advanced Bash-Scripting Guide]]></title>
	<description><![CDATA[<p>This tutorial assumes no previous knowledge of scripting or programming, yet progresses rapidly toward an intermediate/advanced level of instruction <em>. . . all the while sneaking in little nuggets of <span>UNIX</span>&reg; wisdom and lore</em>. It serves as a textbook, a manual for self-study, and as a reference and source of knowledge on shell scripting techniques. The exercises and heavily-commented examples invite active reader participation, under the premise that <tt><strong>the only way to really learn scripting is to write scripts</strong></tt>.</p>
<p>This book is suitable for classroom use as a general introduction to programming concepts.</p>
<p>More at http://tldp.org/LDP/abs/html/</p><p>Address of the bookmark: <a href="http://tldp.org/LDP/abs/html/" rel="nofollow">http://tldp.org/LDP/abs/html/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26426/genome-browser-gbrowse</guid>
	<pubDate>Fri, 19 Feb 2016 09:22:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26426/genome-browser-gbrowse</link>
	<title><![CDATA[Genome Browser : GBrowse]]></title>
	<description><![CDATA[<p>Generic Genome Browser Version 2: A Tutorial for Administrators</p>
<p>This is an extensive tutorial to take you through the main features and gotchas of configuring GBrowse as a server. This tutorial assumes that you have successfully set up Perl, GD, BioPerl and the other GBrowse dependencies. If you haven't, please see the <a href="http://gmod.org/wiki/GBrowse_2.0_HOWTO">GBrowse HOWTO</a> During most of the tutorial, we will be using the "in-memory" GBrowse database (no relational database required!) Later we will show how to set up a genome size database using the berkeleydb and MySQL adaptors.</p>
<p>More at http://elp.ucdavis.edu/tutorial/tutorial.html</p><p>Address of the bookmark: <a href="http://elp.ucdavis.edu/tutorial/tutorial.html" rel="nofollow">http://elp.ucdavis.edu/tutorial/tutorial.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32011/fools-guide</guid>
	<pubDate>Sun, 02 Apr 2017 14:31:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32011/fools-guide</link>
	<title><![CDATA[Fools guide]]></title>
	<description><![CDATA[<p><span>This website and accompaning documents are intended as a tool to help researchers dealing with non-model organisms acquire and process transcriptomic high-throughput sequencing data without having to learn extensive bioinformatics skills. It covers all steps from tissue collection, sample preparation and computer setup, through addressing biological questions with gene expression and SNP data.</span></p>
<p>http://sfg.stanford.edu/denovo.html</p>
<p>http://sfg.stanford.edu/sequencing.html</p>
<p>http://sfg.stanford.edu/BLAST.html</p>
<p>http://sfg.stanford.edu/denovo.html&nbsp;</p><p>Address of the bookmark: <a href="http://sfg.stanford.edu/guide.html" rel="nofollow">http://sfg.stanford.edu/guide.html</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</link>
	<title><![CDATA[Pattern Matching Problem Solution with Perl]]></title>
	<description><![CDATA[<p>Problem at http://rosalind.info/problems/1c/</p><p>#Find all occurrences of a pattern in a string.<br />#Given: Strings Pattern and Genome.<br />#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.<br /><br />use strict;<br />use warnings;<br /><br />my $string="GATATATGCATATACTT";<br />my $subStr="ATAT";<br />my $kmer=length($subStr);<br /><br />kmerMatch ($string, $subStr, $kmer);<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />for (my $aa=0; $aa&lt;=(length($string)-$kmer); $aa++) {<br />&nbsp;&nbsp;&nbsp; my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp;&nbsp; if ($myWin eq $myStr) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; #print "$myWin eq $myStr\n";<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; print $aa;<br />&nbsp;&nbsp;&nbsp; }<br />}<br />}</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</guid>
	<pubDate>Sun, 28 Jun 2015 07:46:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</link>
	<title><![CDATA[BioScripts]]></title>
	<description><![CDATA[<p>You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks.</p>
<p>The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.</p>
<p>https://code.google.com/p/biowiki/</p>
<p>https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk</p>
<p>NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&amp;projectsearch=Search+projects</p>
<p>NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&amp;projectsearch=Search+projects</p><p>Address of the bookmark: <a href="https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search" rel="nofollow">https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</guid>
	<pubDate>Thu, 22 Dec 2016 10:30:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</link>
	<title><![CDATA[Finding Patterns in Biological Sequences]]></title>
	<description><![CDATA[<p>In this report we provide an overview of known techniques for discovery of patterns of biological sequences (DNA and proteins). We also provide biological motivation, and methods of biological verification of such patterns. Finally we list publicly available tools and databases for pattern discovery. On-line supplement is available through http://genetics.uwaterloo.ca/&sim;tvinar/cs798g/motif.</p><p>Address of the bookmark: <a href="http://engr.case.edu/li_jing/papers/00798gpattern.pdf" rel="nofollow">http://engr.case.edu/li_jing/papers/00798gpattern.pdf</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</guid>
	<pubDate>Thu, 22 Jan 2015 22:29:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</link>
	<title><![CDATA[Bioinformatics Scripts]]></title>
	<description><![CDATA[<p>Some of the useful bioinformatics scripts.</p>
<p>For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.</p>
<p>http://milkweedgenome.org/?q=scripts</p><p>Address of the bookmark: <a href="http://milkweedgenome.org/?q=scripts" rel="nofollow">http://milkweedgenome.org/?q=scripts</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>