<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26573?offset=1020</link>
	<atom:link href="https://bioinformaticsonline.com/related/26573?offset=1020" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12940/ra-at-iiser-kolkata-computational-biologybioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 06:24:28 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at IISER Kolkata Computational Biology/Bioinformatics]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for research associate (post-doc; Rs. 22000-32000)/research fellow (16000-18000)/project assistant (Rs. 10000-14000) positions in the Department of Biological Sciences, Indian Institute for Science Education and Research Kolkata in the extramural project. Condition to satisfactory performance, the positions is for a period of upto 2 years (or funding of the project).</p>

<p>Brief description: We are looking for suitable candidates in the area o computational biology/bioinformatics/genomics or related field for next-generation sequencing (NGS) data analysis for small-RNAs, RNA-Seq and targeted resequencing of plants and associated organisms. We are an interdisciplinary group where projects equally involve bioinformatics and systems biology (specially microarrays and next-generation sequencing (NGS) data analysis and its use), along with plant molecular biology, genetic engineering, field biology, and analytical plant chemistry for understanding response of plants to biotic stresses.</p>

<p>Essential qualification: MSc/BTech/MTech/PhD (or other suitable qualification) in disciplines preferable to bioinformatics, computational biology, computer application (or equivalent)/ ‘Advance Post-Graduate Diploma in Bioinformatics’. Proficiency in programming languages (such as Perl, C++) and/or statistics (proficient in R for example) is compulsory.</p>

<p>Desirable qualification: Experience in the field of genomics e.g. microarray analysis, NGS, genome annotation, database development and management, software development, systems and network biology (or related fields) will be preferred.</p>

<p>Application process: Applications should contain CV along with brief description (maximum 1 page) of research conducted (highlighting skills and experience) till now. Applications should be sent by e-mail to Shree Prakash Pandey, Department of Biological Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur Campus, WB, India within 14 days of this advertisement.</p>

<p>E-mail: sppiiserkol@gmail.com, sppandey@iiserkol.ac.in</p>

<p>Advertisement:</p>

<p>http://www.iiserkol.ac.in/announcements/adverts/671-advt_ra_shree_prakash_july_2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</guid>
	<pubDate>Sun, 27 Jul 2014 20:44:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</link>
	<title><![CDATA[You and your friend have similar DNA !!!]]></title>
	<description><![CDATA[<p>New research out of Massachusetts claims that people often choose friends that are similar to them in genetics and they are more accurate than you might suppose. A study published on PNAS&nbsp;http://www.pnas.org/content/111/Supplement_3/10796.full found that people are apt to pick friends who are genetically similar to themselves - so much so that friends tend to be as alike at the genetic level as a person's fourth cousin.</p><div style="text-align: center;"><img src="http://i.kinja-img.com/gawker-media/image/upload/s--CwLwHa43--/18fbmlokxcmqcjpg.jpg" alt="image" width="300" height="271" style="border: 0px; border: 0px;"></div><p>Scientists with a long-running Framingham Heart Study looked at 1,932 people (examination of about 1.5 million markers of genetic variations), comparing unrelated friends to unrelated strangers. They found that friends shared about 1% of their genes &mdash; a percentage much higher than those shared with strangers.This new findings made it clear that people have more DNA in common with those who are selected as friends than with strangers in the same population.&nbsp;</p><p>The genes that lined up the most were olfactory genes, which deal with smell. The ones that lined up the least were immune system genes. The researchers weren't sure why that happened :/. Olfactory genes might be a straightforward explanation: People who like the same smells tend to be drawn to similar environments, where they meet others with the same tendencies.</p><p>Reference:</p><p>http://www.pnas.org/content/111/Supplement_3/10796.full</p><p>Image : http://i.kinja-img.com</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13338/protein-function-annotation-and-machine-learning-upmc-paris-france</guid>
  <pubDate>Sat, 02 Aug 2014 01:22:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[Protein function annotation and machine learning - UPMC - Paris, France]]></title>
  <description><![CDATA[
<p>Protein function annotation and machine learning - UPMC - Paris, France</p>

<p>Job Description: We are interested in finding an excellent postdoc with interests in protein functional annotation, machine learning and computer grids. The position is open for 3.5 years at the Université Pierre et Marie Curie, in the heart of paris.</p>

<p>Research topic: Protein function annotation, multiple probabilistic models, domain architecture, machine learning, combinatorial optimization, computer grid.</p>

<p>Title: A novel integrative platform for large scale protein annotation that exploits a multitude of diversified probabilistic models in several protein signature databases.</p>

<p>We propose a novel integrated approach for large scale protein annotation that will exploit an unprecedented amount of genomic data as well as sophisticated machine learning techniques and combinatorial optimization approaches taking advantages of High Performance Computing (HPC) environments. The idea is to uncover as much as possible the evolutionary processes of protein sequences that took place throughout the whole tree of life and that affected the evolution of a protein family. We have already demonstrated in a previous work that the problem of functional annotation is inherent to the ability of uncovering such paths. Now, we shall extend this approach to large scale genome annotation by considering 11 different protein databases, constituted by about 10^9 protein sequences, and by producing a large pool of diversified probabilistic models coding for about 10^7 evolutionary protein pathways. Such models will be used to search for specific domains in genomes to be annotated. Our previous methodology needs to be fundamentally improved to deal with this large amount of biological data. In this project, we shall work on the algorithms to reduce the space of models and the search complexity, and we shall implement some important algorithmic changes towards the realization of a powerful integrated annotation tool.</p>

<p>Where: This project is run on the Laboratoire de Biologie Computationnelle et Quantitative UMR7238 CNRS-UPMC – Analytical Genomics team, headed by A.Carbone. It is co-advised with Pierre-Henri Wuillemin, Laboratoire d’Informatique de Paris 6 – Equipe DECISION.</p>

<p>Start date: September 1st, 2014<br />Contact Person: Alessandra Carbone<br />Contact: alessandra.carbone@lip6.fr</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14050/assistant-professor-in-bioinformatics-at-indian-institute-of-technology-delhi</guid>
  <pubDate>Fri, 15 Aug 2014 06:16:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor 	in Bioinformatics at Indian Institute of Technology Delhi]]></title>
  <description><![CDATA[
<p>Indian Institute of Technology Delhi Hauz Khas ,New Delhi – 110016</p>

<p>ROLLING ADVERTISEMENT NO. 01/2014(E-1)<br />ADVERTISEMENT FOR THE POSITIONS OF ASSISTANT PROFESSOR CANDIDATES CAN APPLY ANY TIME DURING THE YEAR.</p>

<p>IIT Delhi invites applications from qualified Indian Nationals, Persons of Indian Origin (PIOs) and Overseas Citizens of India (OCIs) for the following positions in the various Departments/Centres/Schools (in the fields<br />mentioned alongwith them):<br />Post Pay Band Assistant Professor and Assistant Professor (on Contract) Rs.15600-39100 (PB-3) (Minimum pay of Rs.30000/-)+ AGP Rs.8000/-</p>

<p>The following norms will be followed for fixing the basic pay + AGP for Assistant Professors appointed on<br />contract with Ph.D but experience of 3 years or less:-<br />Type Qualification &amp; Experience on the date of joining<br />Assistant Professor (Contract) PB3 (Rs. 15,600-39,100).</p>

<p>MINIMUM QUALIFICATIONS AND EXPERIENCE:<br />Ph.D. with First class at the preceding degree or equivalent in the appropriate branch with very good academic record throughout. A minimum of three years industrial/research/teaching experience, excluding however, the experience gained while Pursuing Ph. D. The candidates should preferably be below<br />35 years of age for male and 38 years for female ( to be relaxed by 5 years in case of persons with physical disability, SC/ST and 3 years in case of OBC-NCL).</p>

<p>Qualified persons include:<br />(a) Indian Nationals,<br />(b) Foreign Nationals who are “Persons of Indian Origin” (PIO) or Overseas<br />Citizens of India (OCI), in whose case, if selected, permission will be sought from Govt. of India<br />before he/she can join IIT Delhi, or<br />(c) Other Foreign Nationals, in whose case, if selected, appointment will be on a contract basis for up to 5 (five) years subject to permission from the Govt. of India before he/she can join IIT Delhi.<br />(d) Institute specifically encourages applicants from SC/ST/OBC category as well as persons<br />with disability to apply for these positions. </p>

<p>AMAR NATH &amp; SHASHI KHOSLA SCHOOL OF INFORMATION TECHNOLOGY:<br />Computational Neuroscience, Medical Applications of Information Technologies, Computational &amp; Systems Biology, Machine to Machine (M2M) Technologies, Embedded Systems &amp; Sensors, Computer Security.<br />KUSUMA SCHOOL OF BIOLOGICAL SCIENCES:<br />In-silico Biology Applications, Systems Biology, Infection Biology, Neurodegeneration. </p>

<p>More at http://www.iitd.ac.in/sites/default/files/jobs/faculty/spl-areas-rolling-advt.pdf</p>

<p>http://www.iitd.ac.in/content/faculty-positions</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14272/lecturersenior-lecturer-level-bc-in-bioinformatics</guid>
  <pubDate>Fri, 22 Aug 2014 12:45:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[Lecturer/Senior Lecturer (Level B/C) in Bioinformatics]]></title>
  <description><![CDATA[
<p>Lecturer/Senior Lecturer (Level B/C) in Synthetic Biology, Research Fellow (Level B) in Synthetic Biology &amp; Lecturer/Senior Lecturer (Level B/C) in Bioinformatics</p>

<p>Apply now Job no: 494553<br />Work type: Continuing full time<br />Vacancy type: External Vacancy, Internal Vacancy<br />Categories: Academic - Teaching and Research</p>

<p>The Faculty of Science is launching a new and innovative branch of biological science at Macquarie University – Synthetic Biology. Synthetic biology combines engineering principles with molecular biological approaches to design and construct biological devices and systems. Recent highlights in this field include the design and synthesis of a functional bacterial genome and a yeast chromosome, and generation of synthetic bacterial cells. The rational synthesis of "designer" organisms yield important insights into how organisms work and has the potential to revolutionise biotechnological applications in areas such as bioenergy and biomanufacturing.</p>

<p>Find more at http://jobs.mq.edu.au/cw/en/job/494553/lecturersenior-lecturer-level-bc-in-synthetic-biology-research-fellow-level-b-in-synthetic-biology-lecturersenior-lecturer-level-bc-in-bioinformatics</p>
]]></description>
</item>

</channel>
</rss>