<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26573?offset=1120</link>
	<atom:link href="https://bioinformaticsonline.com/related/26573?offset=1120" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34585/r-googlevis-examples</guid>
	<pubDate>Sun, 10 Dec 2017 06:13:42 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34585/r-googlevis-examples</link>
	<title><![CDATA[R googleVis examples]]></title>
	<description><![CDATA[<p>It may take a little while to load all charts. Please be patient. All charts require an Internet connection.</p>
<p>These examples are taken from the googleVis demo. You can execute the demo via</p>
<pre><code><span>library</span><span>(</span><span>googleVis</span><span>)</span>
<span>demo</span><span>(</span><span>googleVis</span><span>)</span>
</code></pre>
<p>For more details about the charts and further examples see the helpfiles of the individual googleVis function and review the&nbsp;<a href="https://developers.google.com/chart/interactive/docs/gallery">Google Charts API documentation</a>&nbsp;and&nbsp;<a href="https://developers.google.com/terms">Terms of Service</a>.</p><p>Address of the bookmark: <a href="https://cran.r-project.org/web/packages/googleVis/vignettes/googleVis_examples.html" rel="nofollow">https://cran.r-project.org/web/packages/googleVis/vignettes/googleVis_examples.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/36585/custom-r-charts-coming-to-excel</guid>
	<pubDate>Sat, 12 May 2018 07:30:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/36585/custom-r-charts-coming-to-excel</link>
	<title><![CDATA[Custom R charts coming to Excel !]]></title>
	<description><![CDATA[<p>This week at the BUILD conference, Microsoft&nbsp;<a href="https://dev.office.com/blogs/azure-machine-learning-javascript-custom-functions-and-power-bi-custom-visuals-further-expand-developers-capabilities-with-excel" target="_blank">announced</a>&nbsp;that Power BI custom visuals will soon be available as charts with Excel. You'll be able to choose a range of data within an Excel workbook, and pass those data to one of the built-in Power BI custom visuals, or one you've&nbsp;<a href="https://github.com/Microsoft/PowerBI-Visuals/" target="_blank">created yourself using the API</a>.</p><p><a href="http://a0.typepad.com/6a0105360ba1c6970c0224e038fa08200d-pi" target="_blank"><img src="https://www.r-bloggers.com/wp-content/plugins/lazy-load/images/1x1.trans.gif" alt="Excel custom visuals" title="Excel custom visuals" style="border: 0px; border: 0px;"></a></p><p>Since you can&nbsp;<a href="https://docs.microsoft.com/en-us/power-bi/desktop-r-visuals?WT.mc_id=Revolutions-blog-davidsmi" target="_blank">create Power BI custom visuals using R</a>, that means you'll be able to design a custom R-based chart, and make it available to people using Excel &mdash; even if they don't know how to use R themselves. There also many&nbsp;<a href="https://appsource.microsoft.com/en-us/marketplace/apps?product=power-bi-visuals&amp;page=1&amp;src=office" target="_blank">pre-defined custom visuals available</a>, including some familiar R charts like&nbsp;<a href="https://appsource.microsoft.com/en-us/product/power-bi-visuals/WA104380817?tab=Overview" target="_blank">decision trees</a>,&nbsp;<a href="https://appsource.microsoft.com/en-us/product/power-bi-visuals/WA104380905?tab=Overview" target="_blank">calendar heatmaps</a>, and&nbsp;<a href="https://appsource.microsoft.com/en-us/product/power-bi-visuals/WA104381492?tab=Overview" target="_blank">hexbin scatterplots</a>.</p><p>For more details on how you'll be able to use custom R visuals in Excel, check out the blog post linked below.</p><p>PowerBI Blog:&nbsp;<a href="https://powerbi.microsoft.com/en-us/blog/excel-announces-new-data-visualization-capabilities-with-power-bi-custom-visuals/" target="_blank">Excel announces new data visualization capabilities with Power BI custom visuals</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</guid>
	<pubDate>Mon, 05 Nov 2018 08:12:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</link>
	<title><![CDATA[MetaPlotR: a Perl/R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites]]></title>
	<description><![CDATA[<p><span>An increasing number of studies are mapping protein binding and nucleotide modifications sites throughout the transcriptome. Often, these sites cluster in certain regions of the transcript, giving clues to their function. Hence, it is informative to summarize where in the transcript these sites occur. A metagene is a simple and effective tool for visualizing the distribution of sites along a simplified transcript model. In this work, we introduce MetaPlotR, a Perl/R pipeline for creating metagene plots.</span></p><p>Address of the bookmark: <a href="https://github.com/olarerin/metaPlotR" rel="nofollow">https://github.com/olarerin/metaPlotR</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38541/geneoverlap-an-r-package-to-test-and-visualize-gene-overlaps</guid>
	<pubDate>Thu, 27 Dec 2018 19:45:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38541/geneoverlap-an-r-package-to-test-and-visualize-gene-overlaps</link>
	<title><![CDATA[GeneOverlap: An R package to test and visualize gene overlaps]]></title>
	<description><![CDATA[<p>Overlapping gene lists can reveal biological meanings and may lead to novel hypotheses. For example, histone modification is an important cellular mechanism that can pack and re-pack chromatin. By making the chromatin structure more dense or loose, the gene expression can be turned on or off. Tri-methylation on lysine 4 of histone H3 (H3K4me3) is associated with gene activation and its genome-wide enrichment can be mapped by using ChIP-seq experiments. Because of its activating role, if we overlap the genes that are bound by H3K4me3 with the genes that are highly expressed, we should expect a positive association. Similary, we can perform such kind of overlapping between the gene lists of different histone modifications with that of various expression groups and establish each histone modification&rsquo;s role in gene regulation.</p><p>Address of the bookmark: <a href="https://bioconductor.org/packages/release/bioc/vignettes/GeneOverlap/inst/doc/GeneOverlap.pdf" rel="nofollow">https://bioconductor.org/packages/release/bioc/vignettes/GeneOverlap/inst/doc/GeneOverlap.pdf</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39917/chromomap-an-r-package-for-interactive-visualization-and-annotation-of-chromosomes</guid>
	<pubDate>Sat, 07 Sep 2019 10:45:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39917/chromomap-an-r-package-for-interactive-visualization-and-annotation-of-chromosomes</link>
	<title><![CDATA[chromoMap-An R package for Interactive Visualization and Annotation of Chromosomes]]></title>
	<description><![CDATA[<p><code>chromoMap</code>&nbsp;provides interactive, configurable and elegant graphics visualization of chromosomes or chromosomal regions allowing users to map chromosome elements (like genes,SNPs etc.) on the chromosome plot.Each chromosome is composed of loci(representing a specific range determined based on chromosome length) that, on hover, shows details about the annotations in that locus range. The plots can be saved as HTML documents that can be shared easily. In addition, you can include them in R Markdown or in R Shiny applications.</p>
<p>Some of the prominent features of the package are:</p>
<ul>
<li>visualizing polyploidy simultaneously on the same plot.</li>
<li>annotating groups of elements as distinct colors.</li>
<li>creating chromosome heatmaps.</li>
<li>adjusting chromosome range or visualizing chromosome regions such as genes</li>
<li>adding labels to the plot</li>
<li>adding hyperlinks to each element</li>
</ul><p>Address of the bookmark: <a href="https://cran.r-project.org/web/packages/chromoMap/vignettes/chromoMap.html" rel="nofollow">https://cran.r-project.org/web/packages/chromoMap/vignettes/chromoMap.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

</channel>
</rss>