BOL: Related items

Luo Lab | Symbiosis Genomics & Evolution

Wed, 09 Sep 2026 03:30:30 -0500

We study the evolutionary genomics of marine invertebrates to understand their origins and diversity. Our lab combines high-throughput sequencing and single-cell transcriptomics to explore a wide range of non-model systems. We are particularly interested in how evolutionary novelty arises, with a focus on animal development and photosymbiosis.

Research Directions

Stony corals: evolution of novelty and photosymbiosis

Symbiotic acoels: cell type evolution and photosymbiosis

Animal genomes: structural evolution and gene regulation

https://sgel.biodiv.tw/home

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Detect the sequence pattern and its location in fasta file with match and mismatches information.

Jit — Thu, 26 Sep 2013 15:02:53 -0500

This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..

To run:

perl centro.pl

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Try R Online

Jitendra Narayan — Tue, 16 Jul 2013 06:15:11 -0500

One of the best R tutorial website, which provide an online interative interface to try and learn R language without any hassle.

Link @ http://tryr.codeschool.com/

Upgrade R 3.0.3

Rahul Nayak — Mon, 10 Mar 2014 11:23:51 -0500

R is a free software programming language and software environment for statistical computing and graphics. The R language is widely used among statisticians and data miners for developing statistical software and data analysis. Polls and surveys of data miners are showing R's popularity has increased substantially in recent years. Recently the new version of R codename “Warm Puppy" have been released.

You can download the latest version from here http://cran.rstudio.com/ . Or, if you are using Windows, you can upgrade to the latest version using the installr package http://cran.r-project.org/web/packages/installr/ . Simply run the following code:

# installing/loading the package:
if(!require(installr)) {
install.packages("installr"); require(installr)} #load / install+load installr

updateR()

I try to keep the installr package updated and useful. If you have any suggestions or remarks on the package, you’re invited to leave a comment below.

If you use the global library system http://www.r-statistics.com/2010/04/changing-your-r-upgrading-strategy-and-the-r-code-to-do-it-on-windows/ , you can run the following in the new version of R:

source("http://www.r-statistics.com/wp-content/uploads/2010/04/upgrading-R-on-windows.r.txt")
New.R.RunMe()

Reference:

http://www.r-statistics.com/2014/03/r-3-0-3-is-released/

RA at University of Delhi

Wed, 17 Jun 2015 20:35:35 -0500

Research Scientist Jobs opportunity in University of Delhi on temporary basis

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

BioStats class tutorial

Shruti Paniwala — Thu, 16 Mar 2017 01:50:50 -0500

Nice biostat turorial by Ingo Ruczinski

Address of the bookmark: http://www.biostat.jhsph.edu/~iruczins/teaching/

At what age did you gain passion in Bioinformatics?

Jit — Tue, 23 Jun 2015 10:39:06 -0500

Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?

R tuorial

Rahul Nayak — Mon, 31 Jul 2017 08:41:40 -0500

R learning resources

https://flowingdata.com/

Address of the bookmark: https://flowingdata.com/