Employer: Jawaharlal Nehru University
Address: Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067
Email: not mentioned / provided for this job post
URL: http://www.jnu.ac.in/Career/currentjobs.htm
Phone: 011 2674 2575
Skills: not mentioned / required for this job post
Experience: Experience in molecular biology, structural biology and bioinformatics is desired
Education: M.Sc. in any field of life sciences.
Job Location: New Delhi, Delhi, India (View Jobs in New Delhi, Jobs in Delhi, Jobs in India)

Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec

Name of the Post: JRF / SRF / RA

Salary: As per rules

Required Job Profile:

Candidate must possess M.Sc. in any field of life sciences.

Desired Job Profile:

Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.

How to apply:

Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.

Refer to http://www.jnu.ac.in/Career/currentjobs.htm

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Sr Research Fellow & Technical Asst Posts: Indian Institute of Maize Research (IIMR), New Delhi has advertised a notification for the recruitment of Senior Research Fellow & Technical Assistant vacancies for the project titled “Genetic modifications to improve biological nitrogen fixation for augmenting nitrogen needs of cereals” on contractual basis. Eligible candidates may apply in prescribed application format on or before 25-06-2015. Other details like age, educational qualification, selection process, how to apply are given below…

Indian Institute of Maize Research Vacancy Details:
Total No. of Posts: 03
Name of the Posts :
1. Senior Research Fellow: 02 Posts
2. Technical Assistant: 01 Post

Age Limit: Candidates age should be 35 years for Senior Research Fellow, Minimum 21 years and maximum 45 years for Technical Assistant as on the closing date of the application. Age relaxation is 5 years to SC/ST and women candidates and 3 years to OBC candidates as per ICAR rules.

Educational Qualification: Candidates should possess Post graduate degree in Biotechnology/ Molecular Biology/ Bioinformatics/ Plant physiology for Senior Research fellow, Graduate degree in Agriculture/ Biotechnology/ any discipline of life sciences for Technical Assistant with relevant experience.

Selection Process: Candidates will be selected based on their performance in interview.

How to Apply: Eligible candidates can send their application in prescribed format along with bio-data to Dr. Pranjal Yadava, Principal Investigator, ICAR Indian Institute of Maize Research, Pusa Campus, New Delhi-110012 or mail to pranjal.yadava@gmail.com on or before 25-06-2015 & attend the interview along with application in the attached format at the time of interview, one passport size photograph, self attested copies of certificates for age, and qualifications, reprints of publications and ‘No Objection Certificate’, original documents on 01-07-2015. Venue details are mentioned below.

Important Dates:
Last Date for Receipt of Application: 25-06-2015
Date & Time of Interview : 01-07-2015.
Venue: IIMR, Pusa Campus, New Delhi

Eligibility : BE/B.Tech(CSE, ECE, IT)

Location : Pondicherry

Last Date : 26 Jun 2015

Hiring Process : Face to Face Interview
Pondicherry University - Job DetailsDate of posting:19 May 15

Senior Technical Assistant Job position in Pondicherry University on temporary basis

Project Title : "Bioinformatics National Certification (BINC) for certifying quality human resource in Bioinformatics"

Qualification : i) B.E/ B.Tech Computer Science/ Electronics & Communication Engineering/ Information Technology with 55% or equivalent marks. ii) One year Experience in relevant field in Government/ Public Sector or reputed Private Organizations. Desirable : Working experience in JSP and ASP/PHP

No. of Post : 01

Department : Biotechnology

Pay : Rs. 27,800/-

Age Limit : 30 Yrs
How to apply

Both above-mentioned posts are purely on temporary basis, extended by one year based on performance and will be terminated with the completion of BINC Program at Pondicherry University. Interested Candidates may send their application in the prescribed format with self-attested copies of all mark sheets and certificates to Dr. Basant K. Tiwary, Coordinator (BINC), Centre for Bioinformatics, Pondicherry University, Puducherry-605 014 before June 26, 2015.

Click Here http://www.pondiuni.edu.in/news/requirement-post-one-senior-technical-assistant-one-computer-assistant-–-dept-biotechnologygove