<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26587?offset=840</link>
	<atom:link href="https://bioinformaticsonline.com/related/26587?offset=840" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22778/sr-research-fellow-technical-asst-at-indian-institute-of-maize-research-india</guid>
  <pubDate>Wed, 17 Jun 2015 18:47:51 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sr Research Fellow &amp; Technical Asst at Indian Institute of Maize Research - India]]></title>
  <description><![CDATA[
<p>Indian Institute of Maize Research Jobs 2015 –</p>

<p>Sr Research Fellow &amp; Technical Asst Posts: Indian Institute of Maize Research (IIMR), New Delhi has advertised a notification for the recruitment of Senior Research Fellow &amp; Technical Assistant vacancies for the project titled “Genetic modifications to improve biological nitrogen fixation for augmenting nitrogen needs of cereals” on contractual basis. Eligible candidates may apply in prescribed application format on or before 25-06-2015. Other details like age, educational qualification, selection process, how to apply are given below…</p>

<p>Indian Institute of Maize Research Vacancy Details:<br />Total No. of Posts: 03<br />Name of the Posts :<br />1. Senior Research Fellow: 02 Posts<br />2. Technical Assistant: 01 Post</p>

<p>Age Limit: Candidates age should be 35 years for Senior Research Fellow, Minimum 21 years and maximum 45 years for Technical Assistant as on the closing date of the application. Age relaxation is 5 years to SC/ST and women candidates and 3 years to OBC candidates as per ICAR rules.</p>

<p>Educational Qualification: Candidates should possess Post graduate degree in Biotechnology/ Molecular Biology/ Bioinformatics/ Plant physiology for Senior Research fellow, Graduate degree in Agriculture/ Biotechnology/ any discipline of life sciences for Technical Assistant with relevant experience.</p>

<p>Selection Process: Candidates will be selected based on their performance in interview.</p>

<p>How to Apply: Eligible candidates can send their application in prescribed format along with bio-data to Dr. Pranjal Yadava, Principal Investigator, ICAR Indian Institute of Maize Research, Pusa Campus, New Delhi-110012 or mail to pranjal.yadava@gmail.com on or before 25-06-2015 &amp; attend the interview along with application in the attached format at the time of interview, one passport size photograph, self attested copies of certificates for age, and qualifications, reprints of publications and ‘No Objection Certificate’, original documents on 01-07-2015. Venue details are mentioned below.</p>

<p>Important Dates:<br />Last Date for Receipt of Application: 25-06-2015<br />Date &amp; Time of Interview : 01-07-2015.<br />Venue: IIMR, Pusa Campus, New Delhi</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22787/senior-technical-assistant-at-pondicherry-university</guid>
  <pubDate>Wed, 17 Jun 2015 20:46:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Technical Assistant at Pondicherry University]]></title>
  <description><![CDATA[
<p>Senior Technical Assistant</p>

<p>Eligibility : BE/B.Tech(CSE, ECE, IT)</p>

<p>Location : Pondicherry</p>

<p>Last Date : 26 Jun 2015</p>

<p>Hiring Process : Face to Face Interview<br />Pondicherry University - Job DetailsDate of posting:19 May 15</p>

<p>Senior Technical Assistant Job position in Pondicherry University on temporary basis  </p>

<p>Project Title : "Bioinformatics National Certification (BINC) for certifying quality human resource in Bioinformatics"</p>

<p>Qualification : i) B.E/ B.Tech Computer Science/ Electronics &amp; Communication Engineering/ Information Technology with 55% or equivalent marks. ii) One year Experience in relevant field in Government/ Public Sector or reputed Private Organizations. Desirable : Working experience in JSP and ASP/PHP</p>

<p>No. of Post : 01</p>

<p>Department : Biotechnology</p>

<p>Pay : Rs. 27,800/- </p>

<p>Age Limit : 30 Yrs<br />How to apply</p>

<p>Both above-mentioned posts are purely on temporary basis, extended by one year based on performance and will be terminated with the completion of BINC Program at Pondicherry University. Interested Candidates may send their application in the prescribed format with self-attested copies of all mark sheets and certificates to Dr. Basant K. Tiwary, Coordinator (BINC), Centre for Bioinformatics, Pondicherry University, Puducherry-605 014 before June 26, 2015.</p>

<p>Click Here http://www.pondiuni.edu.in/news/requirement-post-one-senior-technical-assistant-one-computer-assistant-–-dept-biotechnologygove</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</guid>
	<pubDate>Tue, 23 Jun 2015 10:55:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</link>
	<title><![CDATA[How long have you been a bioinformatics scientist for?]]></title>
	<description><![CDATA[<p>Most of the researcher have been a scientist whole life, but infact they actually started paying&nbsp; it with at certain time.So, how long have you been in bioinformatics domain now?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22966/ra-bioinformatics-at-icged</guid>
  <pubDate>Sun, 28 Jun 2015 12:24:01 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at ICGED]]></title>
  <description><![CDATA[
<p>Research Associate Position at ICGEB, New Delhi with Dr. Amit Sharma</p>

<p>Starting 15th July 2015, the position relates to a project specifically for in silico drug docking, screening, design, optimisation and linkage with active chemists. </p>

<p>Experience in many docking softwares and operating systems is essential. </p>

<p>Additional experience in bioinformatics and computational biology tools will be useful. </p>

<p>Submit curriculum vitae to: sb.icgeb@gmail.com</p>

<p>Closing date: 5 July 2015</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/23160/opencpu</guid>
	<pubDate>Sun, 05 Jul 2015 18:34:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/23160/opencpu</link>
	<title><![CDATA[OpenCPU]]></title>
	<description><![CDATA[<p>OpenCPU is a system for embedded scientific computing and reproducible research. The OpenCPU server provides a reliable and interoperable <a href="https://www.opencpu.org/api.html">HTTP API</a> for data analysis based on R.</p><p>The OpenCPU <a href="https://www.opencpu.org/jslib.html">JavaScript client library</a> provides the most seamless integration of R and JavaScript available today.</p><p>OpenCPU uses standard R packaging to develop, ship and deploy web applications. Several open source <a href="https://www.opencpu.org/apps.html">example apps</a> are available from Github.</p><p>Installing your own OpenCPU server is <a href="https://www.opencpu.org/download.html">super easy</a> and only takes a few minutes.</p><p>More at https://www.opencpu.org/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24042/research-associate-bioinformatician-university-of-bristol</guid>
  <pubDate>Wed, 26 Aug 2015 05:46:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatician @ University of Bristol]]></title>
  <description><![CDATA[
<p>This 0.5 fte role will have specific responsibility for the bioinformatic side of a Health Innovation Challenged Fund (HICF) research project investigating the application of Next Generation Sequencing (NGS) technologies to the analysis of Minimal Residual Disease (MRD) in childhood Acute Lymphoblastic Leukaemia (ALL). The successful candidate will be responsible for designing and implementing an analysis pipeline primarily to fit with the clinical need, but with the capacity to answer innovative research questions.</p>

<p>For informal enquiries please contact Anne Walsh via email: anne.walsh@bristol.ac.uk.</p>

<p>Apply at http://www.bris.ac.uk/jobs/find/details.html?nPostingID=3639&amp;nPostingTargetID=13346&amp;option=28&amp;sort=DESC&amp;respnr=1&amp;ID=Q50FK026203F3VBQBV7V77V83&amp;JobNum=ACAD101624&amp;Resultsperpage=10&amp;lg=UK&amp;mask=uobext</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23283/ra-bioinformatics-at-iisr</guid>
  <pubDate>Mon, 13 Jul 2015 02:12:10 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at IISR]]></title>
  <description><![CDATA[
<p>Bioinformatics Research Associate at Indian Institute of Spice Research</p>

<p>Pay Scale: Rs. 40,000/-per month +HRA (as admissible) for Ph.D. holders and Rs. 38,000/-p.m. + HRA (as admissible) for Master degree holder</p>

<p>Qualifications: a)Essential :</p>

<p>Ph.D.in Biotechnology/ Molecular B iology/ Genetics &amp; Plant Breeding/ Bioinformatics ( Should have the degree in life sciences at gra duate level) OR Post - Graduation in Biotechnology/ Molecular Biology/ Bioinformati cs/Genetics &amp; Plant Breeding</p>

<p>or equivalent with at least two years of research experience and 60% marks. ( should have a degree in life sciences at graduate level)</p>

<p>b) Desirable :</p>

<p>1. Working experience in plant molecular biology</p>

<p>2. Knowledge of Computational Genomics/Proteomics/ Bioinformatics</p>

<p>3. Working knowledge on Computer programming</p>

<p>Walk-in Interview will be held at The Indian Institute of Spices Research, Marikunnu P.O., Kozikode-673012, Kerala on 28/7/2015 at 10.00 AM.</p>

<p>For more details: http://www.spices.res.in/pdf/Mining%20and%20Validation%20Website.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23403/bioinformatics-project-assistant-at-vector-control-research-centre-vcrc-puducherry</guid>
  <pubDate>Sun, 19 Jul 2015 19:22:07 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Project Assistant at Vector Control Research Centre (VCRC), Puducherry.]]></title>
  <description><![CDATA[
<p>Applications are invited upto 27.07.2015 for filling up of one post of Project Assistant (UNRESERVED) to work under ICMR funded Non-Institutional adhoc project entitled “Biomedical Informatics centre’s of ICMR” at Vector Control Research Centre (VCRC), Puducherry.</p>

<p>Desirable qualification: M.Sc (Life Sciences) with Bioinformatics knowledge and hands on molecular biology tools.</p>

<p>Age: Not exceeding 30 years on the last date of receipt of application</p>

<p>Job work: Molecular modelling studies, Database curation, Metagenomic studies on Dengue virus</p>

<p>Advertisement: http://vcrc.res.in/writereaddata/BIPrj15.pdf</p>
]]></description>
</item>

</channel>
</rss>