<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/26909?offset=420</link>
	<atom:link href="https://bioinformaticsonline.com/related/26909?offset=420" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5210/sandelin-group</guid>
  <pubDate>Mon, 30 Sep 2013 19:12:58 -0500</pubDate>
  <link></link>
  <title><![CDATA[Sandelin group]]></title>
  <description><![CDATA[
<p>Sandelin group have a deep interest in most biology, but focus on gene regulation and the many areas that are connected with this, including transcriptomics, epigenetics and technological and informatics aspects.</p>

<p>The group is both computational and experimental.</p>

<p>We ask biological questions to large datasets made using novel genomics techniques, with the help of computers. One of the strengths in the group are the many connections to high-profile experimental laboratories which supply data to be analyzed.</p>

<p>Lab webpage @ http://people.binf.ku.dk/albin/Sandelin_group_at_the_Bioinformatic_Centre/The_Sandelin_group.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4945/national-training-on-bioinformatics-computational-tools-for-microbial-research-nov-19-to-30-2013</guid>
  <pubDate>Fri, 27 Sep 2013 10:49:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Training on Bioinformatics  Computational Tools for Microbial Research  Nov 19 to 30, 2013]]></title>
  <description><![CDATA[
<p>Agricultural research in modern scientific arena is being represented by proper integration among various research fields of biological, chemical and physical sciences, because this field encompasses many more complexities of biology in nature. In the era of fast accumulating biological data coming out from the research on many crop plants, live stocks and microbes and the impact of changing climate, habitat and other interrelations on these biological entities, bioinformatics has come forward across the globe to solve the problems of analysis, prediction, storage, management, pattern recognition, submission, retrieval and storage of the data to find out a fruitful outcome. This area is becoming increasingly important in the context of systems biology approach where a holistic approach is required to understand the biology and chemistry of the biological entities and their behavior during environmental interactions to resolve the harmful impact of biotic or abiotic causes on crop plants, animals, fishes, livestock sector, beneficial insects as well as microbes. The National Training program on ‘Computational Tools for Microbial Research” is an initiative for the capacity building of NARS scientists/researchers in this most emerging area and fast developing area of i.e. agricultural bioinformatics.</p>

<p>Contact The Director, National Bureau of Agriculturally Important Microorganisms, Kusmaur, Maunath Bhanjan-275101 (U.P.); Phone: 0547-2530080, Fax: 0547-2530358, e mail: nbaimicar@gmail.com; website: www.nbaim.org.in OR</p>

<p>Dr. Dhananjaya P. Singh, Senior Scientist &amp; CCPI, NABG project, NBAIM, Maunath Bhanjan, 275101; Mob.- 09415291703; e mail - dpsfarm@rediffmail.com, nabg.nbaim@gmail.com </p>

<p>More at http://www.nbaim.org.in/Announc.aspx?cd=36</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23924/embl-postdoc-position-in-bacterial-gene-gain-loss</guid>
  <pubDate>Thu, 20 Aug 2015 14:09:21 -0500</pubDate>
  <link></link>
  <title><![CDATA[EMBL Postdoc position in Bacterial Gene Gain Loss]]></title>
  <description><![CDATA[
<p>A post-doctoral fellowship is available in the research groups of Nick Goldman (EBI) and John Welch (Genetics Department, Cambridge University) under the EMBL-EBI / Cambridge Computational Biomedical Postdoctoral Fellowship scheme.</p>

<p>The project is on bacterial gene gain and loss and emerging pathogenicity, and is described in full here: https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015 . The EMBL-EBI / Cambridge Computational Biomedical Postdoctoral (“EBPOD”) </p>

<p>The closing date for applications is 3 September 2015. Nick Goldman EMBL-European Bioinformatics Institute Nick Goldman </p>

<p>More at https://www.ebi.ac.uk/research/postdocs/ebpods/projects/goldman-welch-2015</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5254/mike-ritchie-lab</guid>
  <pubDate>Wed, 02 Oct 2013 15:25:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mike Ritchie Lab]]></title>
  <description><![CDATA[
<p>Mike Ritchie Lab primary research focus is the detection of susceptibility genes for common diseases such as cancer, diabetes, hypertension, and cardiovascular disease, among others. The approaches will involve the development and application of new statistical methods with a focus on the detection of gene-gene interactions associated with human disease.</p>

<p>Gene expression and protein expression patterns between normal and non-normal tissues is a growing area of research that may lead to the identification of candidate genes for understanding the etiology of common, complex diseases. </p>

<p>Lab homepage @ http://ritchielab.psu.edu/ritchielab/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5403/research-associate-icgeb-new-delhi</guid>
  <pubDate>Wed, 09 Oct 2013 13:49:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate @ ICGEB, New Delhi.]]></title>
  <description><![CDATA[
<p>Applications are invited for Research Associate position in the DBT Sponsored Bioinformatics Infrastructure Facility at ICGEB, New Delhi.</p>

<p>Essential requirements: Experience of using bioinformatics tools.</p>

<p>Experience of working in Linux. Basic knowledge of computer network administration.</p>

<p>Desirable: Knowledge of Linux installation/administration and proficiency in either of the following:</p>

<p>Shell/PERL/Java/Python/VB/Oracle/MySQL/C/CUDA.</p>

<p>Qualification: PhD. or First class M.Sc degree in Bioinformatics or Biotechnology/life science with specialization in Bioinformatics.</p>

<p>Fellowships: Rs 22,000/- with HRA for PhD qualified, Rs 16000/- with HRA for NET/BET/BINC/GATE qualified and 12000/- with HRA for non NET qualified applicants.</p>

<p>Interested candidates may send their complete biodata along with a write-up of their experience and suitability for the position to Dr. Dinesh Gupta by email only to dinesh@icgeb.res.in within 15 days of publication of this advertisement. Kindly mark the email with subject “Application for BIF-RA-2013”</p>

<p>Closing date for applications: 18 October 2013</p>

<p>Only short listed candidates will be invited for an interview at ICGEB.</p>

<p>No TA/DA will be paid for attending the interview.</p>

<p>Advertisement: http://www.icgeb.org/tl_files/Vacancies/BIF-RA-Advt.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5574/srfjrfra-university-of-hyderabad</guid>
  <pubDate>Mon, 14 Oct 2013 07:49:11 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF/JRF/RA @ UNIVERSITY OF HYDERABAD]]></title>
  <description><![CDATA[
<p>SCHOOL OF CHEMISTRY, UNIVERSITY OF HYDERABAD</p>

<p>Applications on plain paper along with details of CV (relevant photocopies of their<br />qualifications/experience and reprints of published work to be attached) are invited from qualified candidates for Research Fellowship in CSIR- sponsored research project.</p>

<p>JRF/SRF/RA (one vacancy)</p>

<p>CSIR sponsored “In silico design, identification and in vitro validation of lead molecule inhibitors to Bcr-Abl kinase”</p>

<p>JRF: M.Sc in Chemistry/ Bioinformatics/ Biotechnology with I division and NET or GATE qualified</p>

<p>SRF: M.Sc in chemistry/ Bioinformatics/ Biotechnology with at least two years of post- M.Sc research experience as evidenced from published papers in standard refereed journals in relevant area</p>

<p>RA: PhD in chemistry/ Bioinformatics/ Biotechnology with research experience in<br />relevant area.</p>

<p>As per CSIR guidelines</p>

<p>Notes:<br />1) You may visit the University of Hyderabad website www.uohyd.ernet.in to learn more about the University of Hyderabad.<br />2) Applicants should note that the appointment to be made is purely temporary and there is no right for claiming for any regular appointment in the University.<br />3) No TA/DA will be paid for attending the interview or at the time of joining the post, if selected.<br />4) The application should be submitted by post/courier/in-person to the address given below on or before November 1st 2013.</p>

<p>Prof. Lalitha Guruprasad<br />W-103, Gurbakhsh Singh Building<br />School of Chemistry<br />University of Hyderabad<br />Hyderabad- 500 046<br />5) Short-listed candidates will be called for interview at a short notice.</p>

<p>Advertisement: http://www.uohyd.ac.in/images/recruitment/chemisry_advt_101013.pdf</p>
]]></description>
</item>

</channel>
</rss>