Here are few companies:

https://mynucleus.com/

https://myome.com/

https://nebula.org/whole-genome-sequencing-dna-test/

Understanding Genome Screening

Genome screening involves analyzing an individual's DNA to identify genetic variations that may influence health and disease susceptibility. This can range from simple single-gene tests to comprehensive whole-genome sequencing. By peering into our genetic blueprint, we can uncover risks for conditions like cancer, diabetes, cardiovascular diseases, and even rare genetic disorders.

The process is straightforward: a saliva or blood sample is collected, and advanced sequencing technologies decipher the genetic code. The results provide a personalized health map, guiding lifestyle modifications, preventive measures, or medical interventions.

A Shift from Reactive to Proactive Healthcare

Traditional healthcare often focuses on treating diseases after they manifest. Genome screening flips this model on its head, enabling a shift toward prevention and early intervention. For instance:

• Cancer Risk Management: Individuals with BRCA1 or BRCA2 gene mutations can opt for enhanced screening programs or preventive surgeries to mitigate their risk of breast and ovarian cancers.

• Cardiovascular Health: Genetic predispositions to conditions like familial hypercholesterolemia can prompt early cholesterol monitoring and lifestyle adjustments.

• Rare Diseases: Identifying carriers of genetic disorders can aid in family planning and reduce the incidence of inherited conditions.

The Ethical and Practical Concerns

While genome screening offers incredible promise, it is not without challenges:

1. Accuracy and Interpretation: Genetic predisposition does not guarantee disease. Misinterpretation of results can lead to unnecessary anxiety or unwarranted medical interventions.

2. Privacy and Data Security: Genetic data is highly sensitive. Ensuring robust data protection measures is crucial to prevent misuse.

3. Accessibility and Equity: High costs and limited availability may restrict access to genome screening, exacerbating health disparities.

Balancing Science and Pseudoscience

The comparison of genome screening to horoscopes isn’t entirely unfounded. Both offer predictive insights, but the scientific foundation of genome screening distinguishes it from astrology. Unlike the alignment of celestial bodies, genetic predictions are based on rigorous data and evidence. However, the probabilistic nature of genetic predispositions underscores the importance of interpreting results in conjunction with clinical and lifestyle factors.

The Road Ahead

As genome screening becomes more affordable and integrated into routine healthcare, its potential to transform lives is immense. Policymakers, healthcare providers, and genetic counselors must collaborate to ensure ethical implementation, public awareness, and equitable access.

Imagine a future where your genetic "horoscope" is a trusted guide, not just a prediction. Early genome screening could help chart a healthier path for generations, making it a cornerstone of personalized medicine. After all, our genes might just hold the key to unlocking a future of better health and well-being.

We have developed panHiTE, a comprehensive and accurate pipeline for TE detection in large-scale population genomes. It has been successfully applied to hundreds of plant population genomes, demonstrating its effectiveness and scalability.

For detailed instructions, please refer to the panHiTE tutorial.

Address of the bookmark: https://github.com/CSU-KangHu/HiTE

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

“It’s like a subway map,” she said, “but for DNA.”

That idea is exactly what Sequence Tube Map brings to life.

Instead of showing a genome as one long, confusing sequence, it displays different genomic paths like routes on a metro map. Where sequences are shared, the paths travel together. Where genetic variation occurs, they branch into different routes and may join again later.

This makes complex genome graphs much easier to explore.

Maya could now see how different haplotypes moved through the same genomic region and where they took different paths. She could even view sequencing reads mapped onto the graph, helping her understand what was happening in regions with genetic variation.

What once looked like a tangled network now looked like a journey.

Sequence Tube Map turns the complexity of graph genomes into a visual story—making it easier for scientists to see how DNA can take different routes.

Read more at  https://github.com/vgteam/sequencetubemap 

and

https://academic.oup.com/bioinformatics/article/35/24/5318/5542397

Demo at https://vgteam.github.io/sequenceTubeMap/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Instead of asking only whether two genes occur together across genomes, CORGIAS asks a deeper question: did these genes actually evolve together, repeatedly gaining or losing their presence in concert, or are they merely travelling together because of their inherited history? The framework introduces two complementary approaches, Ancestral State Adjustment (ASA) and the Simultaneous EVolution test (SEV), which incorporate evolutionary information into the search for gene associations. This distinction becomes increasingly important as genome sequencing continues to uncover enormous numbers of microbial genomes, many from organisms that have never been cultured and whose genes remain functionally mysterious. In this growing genomic landscape, simply finding a gene is no longer enough—we need clues about what that gene might be doing. CORGIAS approaches this problem almost like a genomic detective: rather than treating every association as evidence, it reconstructs the evolutionary story behind the association and asks whether the evidence survives that history. By doing so, it offers a way to separate coincidence from biological connection and potentially uncover functional relationships hidden within the vast microbial genomic landscape. The broader message is beautifully simple: genes do not evolve in isolation, and understanding what they do may require us to look beyond where they are today and reconstruct how they arrived there. Sometimes, the most important clue in a genome is not the gene itself, but the evolutionary journey it has taken.

More at https://academic.oup.com/nargab/article/7/4/lqaf182/8377910?

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

You can also add your favourite NGS educational material, or workshop tutorial by commenting on this bookmarks for user benefit. 

Understanding the basics of genome sequencing:

Tutorial by Luke Jostins.

http://www.genetic-inference.co.uk/blog/2009/04/basics-sequencing-dna-part-1/

http://www.genetic-inference.co.uk/blog/2009/08/basics-sequencing-dna-part-2/

A window into third-generation sequencing

http://hmg.oxfordjournals.org/content/19/R2/R227.full.pdf

==============================================

NGS data analysis pipelines

• Detecting and annotating genetic variations using the HugeSeq pipeline  DOI: 10.1038/nbt.2134
• NARWHAL, a primary analysis pipeline for NGS data http://bioinformatics.oxfordjournals.org/cgi/content/abstract/28/2/284?etoc
• RseqFlow: Workflows for RNA-Seq data analysis  DOI: 10.1093/bioinformatics/btr441
• ngs_backbone: a pipeline for read cleaning, mapping and SNP calling using Next Generation Sequence  10.1186/1471-2164-12-285
• A framework for variation discovery and genotyping using next-generation DNA sequencing data  PubMed: 21478889
• SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects  DOI: 10.1186/1471-2105-12-134 Abstract: http://www.biomedcentral.com/1471-2105/12/134/abstract
• WEP: a high-performance analysis pipeline for whole-exome data http://www.biomedcentral.com/1471-2105/14/S7/S11
• DDBJ read annotation pipeline: a cloud computing-based pipeline for high-throughput analysis of next-generation sequencing data. http://www.ncbi.nlm.nih.gov/pubmed/23657089
• GATK: a Toolkit for Genome Analysis http://www.broadinstitute.org/gatk/
• Metagenomics:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsmetagenomics/
• RNASeq:http://www.nbic.nl/education/nbic-phd-school/course-schedule/ngsrnaseq/
• Bioinformatics and Seq courses: http://www.isb-sib.ch/training/training-activities-schedule/archive-2013.html
• Variant Detection (Model organism) Advanced tutorial https://docs.google.com/document/pub?id=1CuKkKylVDb03tnN7RSWl5EUzleetn0ctjmvaidPKLxM
• Variant Detection Introductory tutorial https://docs.google.com/document/pub?id=1ZRzrjjOCvtAu3m-IKL-rbJ1f4On60dDL_IEwG7oejdI
• Microbial de novo Assembly for Illumina Data Introductory tutorial https://docs.google.com/document/pub?id=1N3AB9ptISUu4zULqe1kXpVF0BDyGb5f5yzxWSJd_WNM
• RNAseq Differential Gene Expression Introductory tutorial https://docs.google.com/document/pub?id=1KbTiBHtvHLfPRZ39AY3uriazrINA8TJzgjjwn1zPP7Y

" Please add your favourite NGS link below in comment section for the benefit of bioinformatics community ". 

Address of the bookmark: http://chagall.med.cornell.edu/NGScourse/