<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27035?offset=1160</link>
	<atom:link href="https://bioinformaticsonline.com/related/27035?offset=1160" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4888/murray-coxs-genomicus-lab</guid>
  <pubDate>Thu, 26 Sep 2013 16:42:42 -0500</pubDate>
  <link></link>
  <title><![CDATA[Murray Cox's Genomicus Lab]]></title>
  <description><![CDATA[
<p>This group interested in modeling genome dynamics in following topics:</p>

<p>---how genetic variation is distributed within and between individuals, <br />---determining how this diversity changes over evolutionary time.</p>

<p>Hence, Cox group work at the interface between biology, statistics and computer science to address questions of outstanding biological importance through intrepretation of large genetic datasets.</p>

<p>Profile:<br />Associate Professor Murray Cox, <br />Inaugural Rutherford Fellow of the Royal Society of New Zealand,  Principal Investigator in the BioProtection Research Center and Associate Investigator in the Allan Wilson Center for Molecular Ecology and Evolution<br />Email : m.p.cox@massey.ac.nz<br />Webpage: http://massey.genomicus.com/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5380/04-informatics-approach-to-cancer-interview-with-dr-joel-saltz</guid>
	<pubDate>Mon, 07 Oct 2013 14:35:43 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5380/04-informatics-approach-to-cancer-interview-with-dr-joel-saltz</link>
	<title><![CDATA[04- Informatics Approach to Cancer - Interview with Dr. Joel Saltz]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/8Kf5EP4LY7k" frameborder="0" allowfullscreen></iframe>For additional information visit http://www.cancerquest.org/joel-saltz-interview.

Dr. Joel Saltz is a Professor in the Departments of Pathology, Biostatistics and Bioinformatics, and Mathematics and Computer Science at
Emory University. Dr. Saltz's research on bioinformatics spans several disciplines.  One project involves applying computer analysis to medical imaging to yield better results for patients.  As an example, a computer program may able to help doctors detect small cancers in a CT scan or mammogram. 

In this interview segment, Dr. Saltz  discusses the informatics approach to cancer.

To learn more about cancer and watch additional interviews, please visit the CancerQuest website at http://www.cancerquest.org.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</guid>
	<pubDate>Fri, 27 Sep 2013 11:28:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</link>
	<title><![CDATA[Evolution and Cancer]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/j3uKOcNwYBw" frameborder="0" allowfullscreen></iframe>Air date:  Wednesday, January 04, 2012, 3:00:00 PM
Time displayed is Eastern Time, Washington DC Local  
 
Category:  Wednesday Afternoon Lectures  
Description:  There is a broad consensus that cancer is the result of somatic cells having serially gained, by a series of mutations, the ability to grow independently, to recruit resources from the circulation and the stroma, to invade local tissues, and to found anatomically distant metastases, ultimately killing the host. From the point of view of the cancer-causing somatic cell population, this is evolution driven by mutation and selection. Genomics has resulted in a parallel consensus that the central functions of all eukaryotes are highly conserved, not only at the level of individual protein functions, but also complex biological pathways and systems. These ideas motivated a comparison between results of molecular genetic studies of experimental evolution in yeast and the molecular genetic phenomena associated with tumorigenesis and tumor progression. We find some very striking similarities, including recurring genomic rearrangements, alterations of the regulation of specific growth-promoting genes, population-genetic features that affect the fitness trajectories of growth rate variants in evolving populations, and physiological and metabolic similarities derived from the conservation of the basic plan of growth and cell multiplication among all eukaryotes. It is hoped that some of the insights from yeast will aid the interpretation of sequence changes found in tumors, especially in the urgent necessity to distinguish 'driver' from 'passenger' mutations." 

David Botstein's fundamental contributions to modern genetics include the development of genetic methods for understanding biological functions and the discovery of the functions of many yeast and bacterial genes. In 1980, Botstein and three colleagues proposed a method for mapping human genes that laid the groundwork for the Human Genome Project. The basic principle of the mapping scheme was to develop, by recombinant DNA techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms when hybridized to restriction digests, or specific fragments, of an individual's DNA. The method was used in subsequent years to identify several human disease genes, such as Huntington's and BRCA1. Variations of this method enabled the sequencing phase of the Human Genome Project. 

In the 1990s Botstein, having moved to Stanford University School of Medicine, collaborated with Patrick O. Brown of Stanford in exploiting DNA microarrays to study genome-wide gene expression patterns in yeast and in human cancers. This required developing a new statistical method and graphical interface, widely used today to interpret genomic data. Botstein also has helped to create, with Michael Ashburner and Gerald Rubin, a bioinformatics initiative to unify the representation of gene and gene product attributes across all species, called Gene Ontology. He graduated from Harvard College and earned his doctorate from the University of Michigan. He worked at Massachusetts Institute of Technology from 1967 to 1988; served as vice president for science at Genentech from 1988 to 1990; chaired the Department of Genetics at the Stanford University School of Medicine from 1990 to 2003; and joined the Princeton University faculty in 2003. He has sat on numerous editorial boards and was the founding editor of Molecular Biology of the Cell. Among recent major awards, Bostein won the Peter Gruber Foundation Prize in Genetics in 2003, the Apple Science Innovator Award in 2008, and the Albany Medical Center Prize in 2010. 

The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. 

For more information, visit: The NIH Director's Wednesday Afternoon Lecture Series  
Author:  Dr. David Botstein, Princeton University  
Runtime:  00:59:58  

Permanent link:  http://videocast.nih.gov/launch.asp?17046]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/5253/pre-or-postdoctoral-research-fellowship-in-structural-bioinformatics-in-padova</guid>
  <pubDate>Wed, 02 Oct 2013 15:12:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pre- or postdoctoral research fellowship in Structural Bioinformatics in Padova]]></title>
  <description><![CDATA[
<p>University of Padova (URL: http://protein.bio.unipd.it/)</p>

<p>A research fellowship is available at the BioComputing Laboratory, University of Padova (URL: http://protein.bio.unipd.it/). A highly motivated and creative candidate is sought to work on structural bioinformatics. Specifically, the project entails the development of novel methods, tools and databases for the analysis of protein structures. The BioComputing Laboratory is a group of a dozen people working on several aspects of prediction of protein structure &amp; function employing techniques at the intersection between biology, medicine, chemistry, physics &amp; computer science. Our aim is to integrate the development of novel methods and their application to biologically relevant problems. We are looking for candidates with a solid Bioinformatics background, programming experience (Python, Perl, C++ and/or Java) and good knowledge of molecular biology (protein structure/function, signalling pathways). Candidates should have a degree with top marks, optionally hold a PhD, and be highly motivated to work on interdisciplinary research. Good knowledge of English, an open-minded spirit, being collaborative and creative are crucial. The fellowship, which should start in late 2013, is initially for one year. It will be commensurate to experience, can be extended depending on performance and may lead to a PhD degree. The successful candidate will be located at the BioComputing Laboratory, University of Padova. Travel support for conferences and/or research visits abroad may be provided. To apply, please send your CV, a brief description of your research background and the names of two (or more) references to Prof. Silvio Tosatto (Email: silvio.tosatto@unipd.it). </p>

<p>Contact Person (Referent): Silvio Tosatto<br />Ref. E-Mail: silvio.tosatto@unipd.it<br />Tel: +39 049 827 6269<br />Fax: +39 049 827 6260<br />Group Web Page: http://protein.bio.unipd.it/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7217/contract-faculty-bioinformatics-at-maulana-azad-national-institute-of-technology</guid>
  <pubDate>Thu, 12 Dec 2013 20:46:52 -0600</pubDate>
  <link></link>
  <title><![CDATA[Contract Faculty-Bioinformatics at Maulana Azad National Institute of Technology]]></title>
  <description><![CDATA[
<p>Contract Faculty-Bioinformatics at Maulana Azad National Institute of Technology</p>

<p>Job Description:F.No.11/10(1)/929 Qualifications: Candidates should have Ph.D. degree. If Ph.D. candidates are not available at least Post Graduate degree with GATE/NET qualification is a must. Walk-in-Interview on 19.12.2013 at 2.30 P.M. to 5.30 P.M .. at Maulana Azad National Institute of Technology: Bhopal For more details,please visit website:http://www.manit.ac.in/manitbhopal/Year2013/Recruitment/Contract_faculty/contract%20faculty%202013-2014.pdf</p>

<p>For more @ http://www.manit.ac.in/manitbhopal/Year2013/Recruitment/Contract_faculty/contract%20faculty%202013-2014.pdf</p>

<p>Web address @ :http://www.manit.ac.in</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/40882/troyanskaya-lab</guid>
  <pubDate>Tue, 04 Feb 2020 06:40:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[Troyanskaya Lab]]></title>
  <description><![CDATA[
<p>The goal of our research is to interpret and distill this complexity through accurate analysis and modeling of molecular pathways, particularly those in which malfunctions lead to the manifestation of disease. We are inventing integrative methods for systems-level pathway modeling through integrative analysis of genome-scale datasets. We apply these approaches in studying challenging biological problems, such as how pathways function in diverse cell types and how they change dynamically.</p>

<p>https://function.princeton.edu/</p>
]]></description>
</item>

</channel>
</rss>