<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27090?offset=1100</link>
	<atom:link href="https://bioinformaticsonline.com/related/27090?offset=1100" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</guid>
	<pubDate>Tue, 18 Feb 2014 11:55:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8382/c-dac-launch-supercomputing-facility-param-bio-blaze</link>
	<title><![CDATA[C-DAC launch supercomputing facility "Param Bio Blaze" !!!]]></title>
	<description><![CDATA[<p>The bioinformatics centre at Centre for Development of Advanced Computing (C-DAC) completed 10 years, this month. Established in 2004, the centre has been widely used by numerous researchers across the globe and has an ultimate aim of making personalised drugs depending on the composition of a human body.<br /><br />When biological data is processed using computer science, statistics, mathematics and engineering, it constitutes bioinformatics. The technological advancements are bringing new dimensions to the understanding of molecular basis of living organisms. There is immense data generated due to computing, but storage and analysis of this data is becoming a challenge, therefore there is an urgent need of supercomputers.</p><p>The&nbsp;C-DAC will launch Param Bio Blaze, a supercomputing facility, to address the challenges in bioinformatics on Tuesday at a three-day symposium, titled: 'Accelerating biology: Computing life'. The supercomputing facility will be inaugurated on Tuesday by Ramakrishna Ramaswamy, vice-chancellor, Central University of Hyderabad at the Yashada. The new C-DAC's facility will have a capacity of 10 teraflop and will be able to analyse human cells and its functions.</p><p><img src="http://www.datacenterjournal.com/wp-content/uploads/2012/06/supercomputer.jpg" alt="image" width="1024" height="632" style="border: 0px; border: 0px;"></p><p><br />Param Bio Blaze will help have a larger storage space and better computing facility for the bioinformatics sector. The facility will help capture the movement of molecules and also interaction between two molecules and the effects.<br /><br />Applications of Param BioBlaze<br /><br />- Collaboration with National Centre for Cell Science for research on Malaria and understanding how the disease spreads<br /><br />- Collaborative work with Tata Memorial hospital on breast cancer and find out the difference between normal tissues and tissues from breast cancer patients<br /><br />- Designing anti-cancer molecules, a collaborative research with the University of Pune</p><p>Reference:</p><p>Times of India</p><p>Image:datacenterjournal.com</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</guid>
	<pubDate>Fri, 14 Feb 2014 13:16:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8330/atlas-of-ancient-inter-ethnic-group</link>
	<title><![CDATA[Atlas of ancient inter-ethnic group !!!]]></title>
	<description><![CDATA[<p>Now a dayz, almost 3% of the world's population lived outside their country of origin. These migration is increasingly being perceived as a force that can contribute to development, and an integral aspect of the global development process.&nbsp; While migrants make important contributions to the economic prosperity of their host countries, the flow of financial, technological, social and human capital back to their countries of origin also is having a significant impact on poverty reduction and economic development.</p><p>However, the ancient invasions and migrations to slavery and trade, history is embroidered with events that led to interactions between previously separate populations. Early humans migrated due to many factors such as changing climate and landscape and inadequate food supply. Historical migration of human populations begins with the movement of Homo erectus out of Africa across Eurasia about a million years ago. Homo sapiens appear to have occupied all of Africa about 150,000 years ago, moved out of Africa 70,000 years ago, and had spread across Australia, Asia and Europe by 40,000 years BC. Indo-Aryan migration from the Indus Valley to the plain of the River Ganges in Northern India is presumed to have taken place in the Middle to Late Bronze Age, contemporary to the Late Harappan phase in India (ca. 1700 to 1300 BC). From 180 BC, a series of invasions from Central Asia followed, including those led by the Indo-Greeks, Indo-Scythians, Indo-Parthians and Kushans in the northwestern Indian subcontinent.</p><p><img src="http://upload.wikimedia.org/wikipedia/commons/3/37/Map-of-human-migrations.jpg" alt="image" style="border: 0px; border: 0px;"></p><p>Using the recent advance technologies researchers have created a historical atlas of instances of such mixing. They use a sophisticated statistical method for making inferences about human history and&nbsp;infer populations interbredings ( happen over the past 4,000 years) with an ease.<br /><br />The study published the findings and presented with an interactive map. http://admixturemap.paintmychromosomes.com/</p><p>These sort of genomic study have some limilation. It is hard to precisely define sources of mixing when it occurred between genetically similar groups, and scenarios involving multiple waves of mixing over time or between multiple groups can be difficult to tease apart. But it is believed that larger sample sizes will improve resolution. These high resolution will provide a deeper understanding of human history.</p><p>Reference:</p><p>http://www.sciencemag.org/content/early/2014/01/28/science.1245938</p><p>http://www.ncbi.nlm.nih.gov/pubmed/21390129?dopt=Abstract&amp;holding=npg</p><p>http://www.csulb.edu/~kmacd/paper-ethnicity.html</p><p>Image: Wikipedia</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9055/computational-biologist-scientist-strand-life-sciences</guid>
  <pubDate>Fri, 14 Mar 2014 11:36:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Computational Biologist Scientist @ Strand Life Sciences]]></title>
  <description><![CDATA[
<p>We are looking for a motivated application scientist to help evaluate, compare, and develop next generation sequencing (NGS) data analysis methods. The successful candidate should be able to quickly understand the state-of-art computational biology techniques, prototype them and perform benchmarking studies. The candidate must also be comfortable working with people from different disciplines and be able to present data analysis results in a clear and effective manner. The candidate is also expected to interact with customers as needed, write technical reports and publish new methods and/or data analysis findings in public forums.</p>

<p>Candidate Requirements: A PhD in computer science, computational biology, Bioinformatics, or a related field, along with sufficient programming skills for prototyping. Experience with next generation sequencing data analysis is required. Candidates with MS degree but with relevant work experience can also be considered. The successful candidate must be motivated and capable of working independently as well as in team environment.</p>

<p>Eligible and interested candidates can email your resumes to rohit at strandls dot com</p>

<p>About Strand Life Sciences: Strand was founded in 2000 by computer science and mathematics professors who recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand’s solutions for life sciences research are robust and easy to use by the most novice user while powerful and configurable for the bioinformatician. Using its award-winning application development platform, AVADIS®, Strand builds innovative products that enable fast and cutting-edge analysis for basic and clinical research, drug discovery and development.</p>

<p>http://www.avadis-ngs.com/careers</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9039/postdoc-position-in-computational-biology</guid>
  <pubDate>Fri, 14 Mar 2014 01:38:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc Position in Computational Biology]]></title>
  <description><![CDATA[
<p>The Computational Biology Group of Interdisciplinary Center for<br />Clinical Research (IZKF) Aachen, RWTH Aachen University Hospital,<br />Aachen, invites applicants for PhD candidate or postdoctoral position<br />in computational biology in one of the following topics:</p>

<p>1) Statistical machine learning methods for the analysis of medical<br />epigenomics data.</p>

<p>2) Sequence analysis algorithms for detection of RNA-DNA interactions.</p>

<p>Applicants should hold a M.Sc . or PhD in Computer Science or related<br />areas. Experience in the analysis of biological sequences, gene<br />expression and gene regulation is desirable. The candidate should have<br />solid programming skills (C, Python and/or R) and acquaintance with<br />Linux. Experience with high performance computing is a plus. The<br />working language of the group is English.</p>

<p>The position is based on the German TV-L 13 salary scale, including<br />all German social benefits (health insurance and pension scheme). The<br />expected starting date is September 2014. Interested candidates should<br />send a CV, statement of research interests and the names of three<br />references to jobs@costalab.org.</p>

<p>More at http://costalab.org/wp/phd-and-postdoc-position-in-computational-biology/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</guid>
	<pubDate>Sun, 16 Mar 2014 06:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</link>
	<title><![CDATA[BioGeek Fun]]></title>
	<description><![CDATA[<p>1. A futuristic computational biology student was told to write "It is in my gene!!!" on the board 100 times as a punishment. here's his response -<br /><br />use warnings;<br />for ($count=1; $count &lt;=100; $count++) { print "It is in my gene!!!";}<br /><br />I guess, he is gonna to be a real biogeek. Nice try though. Smart kid.</p><p>&nbsp;</p><p>2. In some perl script I found this <br />&nbsp;. . . . . .<br />&nbsp;. . . . . .<br /># It works for me, only God understood how it is working<br />while (/(&lt;\/[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)$|([^&gt;&lt;]+)/go) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $startGene=$1;<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $beginChromosome=$2;<br />&nbsp;&nbsp; &nbsp;<br />. . . . . .<br />&nbsp;.. . . . . .<br />}</p><p>&nbsp;</p><p>3. One more interesting message in Perl found &hellip;. It will must tickle you bone :) <br />open(my $fh, "&lt;", "gene.txt")&nbsp;&nbsp; &nbsp;or kill " Me if you think this is a mistake :$!";<br /><br /></p><p>&nbsp;</p><p>4. From the Perl <br /><br />&nbsp; while () {&nbsp; # "The Mothership Connection is here!"<br />&nbsp;&nbsp; &nbsp;print &ldquo;$_\n&rdquo;; # Printing the offspring :)</p><p>&nbsp;</p><p>5. Perl message<br />if ($1) { print &ldquo;Just found a the error in chromosome !!!, yahoo&hellip;&rdquo;; else { &ldquo;That is not error, but mutation you moron!&rdquo;;</p><p>&nbsp;</p><p>6. One genome database curator walk in wine bar asked the bartender:<br />CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>