<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27090?offset=700</link>
	<atom:link href="https://bioinformaticsonline.com/related/27090?offset=700" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7567/asst-professor-jaipur-national-university</guid>
  <pubDate>Fri, 27 Dec 2013 19:54:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Asst. Professor @ JAIPUR NATIONAL UNIVERSITY]]></title>
  <description><![CDATA[
<p>JAIPUR NATIONAL UNIVERSITY</p>

<p>Established by Government of Rajasthan</p>

<p>Approved by UGC under Sec 2(f) of UGC Act 1956</p>

<p>ADVERTISEMENT FOR FACULTY POSITION AT JAIPUR NATIONAL UNIVERSITY,JAIPUR</p>

<p>Jaipur National University, Jaipur is a premier centre of learning, providing various integrated and interdisciplinary programmes of study and research in the country. With the opening of the School of Distance Education &amp; Learning, JNU has taken education to the doorsteps of those aspirants who, for some reason, could not be a part of regular stream of education. In this era of competition &amp; ambition for excellence, it has become imperative to have quality education &amp; an alert mind coupled with the right attitude to carry onself, and for this, JNU happens to be the most sought after destination.</p>

<p>School Of Life Sciences: Bioinformatics, Chemistry</p>

<p>Total no of Post: 04</p>

<p>Education:</p>

<p>PG – M.Sc /M.Tech Bioinformatics</p>

<p>PG – M.Sc /M.Tech Chemistry</p>

<p>Experience:</p>

<p>Candidate with 1-2 years of teaching experience in college/ University will be preffered. Freshers may also apply.</p>

<p>Compensation: Compensation will not be a problem for the right candidate</p>

<p>HOW TO APPLY:</p>

<p>SEND THE UPDATED RESUME THROUGH MAIL OR POST AT</p>

<p>dsbhatia5@yahoo.com</p>

<p>contact no: 7568246839</p>

<p>Website: http://www.jnujaipur.ac.in</p>

<p>Please mail your resume to Prof.D.S.Bhatia</p>

<p>Email Address: dsbhatia5@yahoo.com</p>

<p>Ph:, +917568246839</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</guid>
	<pubDate>Wed, 10 Jan 2018 03:10:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</link>
	<title><![CDATA[GIGGLE: a search engine for large-scale integrated genome analysis]]></title>
	<description><![CDATA[<p><span>GIGGLE is a genomics search engine that identifies and ranks the significance of genomic loci shared between query features and thousands of genome interval files. GIGGLE (</span><a href="https://github.com/ryanlayer/giggle">https://github.com/ryanlayer/giggle</a><span>) scales to billions of intervals and is over three orders of magnitude faster than existing methods. Its speed extends the accessibility and utility of resources such as ENCODE, Roadmap Epigenomics, and GTEx by facilitating data integration and hypothesis generation.</span></p>
<p>https://www.nature.com/articles/nmeth.4556</p><p>Address of the bookmark: <a href="https://github.com/ryanlayer/giggle" rel="nofollow">https://github.com/ryanlayer/giggle</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7933/senior-programmer-biotech-park</guid>
  <pubDate>Mon, 20 Jan 2014 04:50:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[SENIOR PROGRAMMER @ Biotech Park]]></title>
  <description><![CDATA[
<p>Advt. No. (1)/BP/2014<br />A walk-in-interview will be held in the Biotech Park Office at Sector G, Jankipuram, Kursi Road, Lucknow (U.P.) January 31, 2014 at 11.00 A.M. for the following posts of DBT sponsored project tenable at Biotech Park. Interested candidates fulfilling the requisite qualifications, experience and age as given below, on the date of interview, may appear before the Selection Committee. The candidate will have to join immediately. Appointment will be made initially for six months extendable on satisfactory performance till the duration of the project.<br />INTERVIEW ON January 31, 2014 at 11.00 A.M.<br /> <br />SENIOR PROGRAMMER (ONE POST)<br />Educational Qualification<br />M.Sc./B. Tech Bioinformatics with minimum 60% marks with two years of relevant experience	<br />Job Requirement	<br />Development of databases in multi user environment and application softwares, updating and maintenance of website, Drug designing and QSAR study etc.<br />Desirable<br />Knowledge of Bioinformatics tools, Windows, Linux, C++, JAVA / JAVA Script, Visual Basic, CGI, DBMS/RDBMS and HTML. Experience in various domains of bioinformatics such as structure based drug designing, Newtonian dynamics and QSAR studies.<br />Age<br />Below 35 years (as on the date of interview)<br />Emoluments<br />Rs. 12,000/- per month fixed.<br />Note: All the candidates should report for interview on or before 10.30 A.M<br />General Conditions<br />The aforesaid positions are purely temporary and do not give the incumbent any right whatsoever for appointment on regular basis.<br />The applicant will have to submit typed and duly signed application on plain paper on the day of interview stating:<br />    (a) Advertisement No.<br />    (b) Position applied for<br />    (c) Name of Applicant (in Block letters)<br />    (d) Father’s Name<br />    (e) Date of Birth<br />    (f) Sex<br />    (g) Age as on the date of interview (dd / mm / yy )<br />    (h) Address (Permanent &amp; correspondence)<br />    (i) Educational Qualifications (High School onwards) with examination passed, year, % marks, subjects<br />    (j) Employment experience, if any i.e. Name of employer, nature of employment, date of joining and leaving.<br />Applications must be accompanied by a latest passport size photograph and attested copies of certificates<br />Original certificates/degree and testimonials should be produced by the candidate for verification at the time of interview.</p>

<p>Tenure: Initially upto six months and extendable based on performance.<br />The upper age limit can be relaxed up to 5 years in the case of applicant belonging to SC/ST/Woman/Physically handicapped and 3 years for OBCs.<br />No TA/DA will be paid for attending the interview.<br />More at http://www.biotechpark.org.in/index1.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8384/post-doc-in-genomics-of-fungi</guid>
  <pubDate>Tue, 18 Feb 2014 13:47:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Genomics of Fungi]]></title>
  <description><![CDATA[
<p>Post-doc in Genomics of Fungi</p>

<p>Fungi are of central importance for the global carbon cycle because of<br />their role in the degredation of complex organic matter such as plant<br />material. Fungi also represent one of the last frontiers of<br />biodiversity, as their taxonomic diversity and metabolic potential<br />remain poorly understood. This is particularly true for those fungi that<br />are abundant in freshwaters.</p>

<p>\"MycoLink\" (Linking aquatic mycodiversity to ecosystem function) is an interdisciplinary project integrating the expertise of 4 Leibniz Institutes: IGB, ZALF, DSMZ, the Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), the Leibniz Centre for Agricultural Landscape Research (ZALF), and the Leibniz-Institute of Zoo- and Wildlife Research in Berlin (IZW). We are seeking to recruit outstanding young scientists to establish an innovative research program, and currently invite applications for:</p>

<p>PostDoc will focus on global biodiversity and evolutionary genomics of freshwater fungi, using second- and third-generation sequencing and bioinformatics to analyse natural populations and experimental cultures. For further information, contact Michael T. Monaghan (monaghan@igb-berlin.de) (http://monaghanlab.org).</p>

<p>PostDoc will focus on the ecological and functional role of aquatic fungi by combining state-of-the-art biochemical analyses with modeling in experimental and natural ecosystems. For further information, contact Hans-Peter Grossart &amp; Katrin Premke (hgrossart@igb-berlin.de; premke@igb-berlin.de)</p>

<p>Applicants must hold a PhD in a relevant field. Positions are available for up to three years. Salary is according to the German TvD. Positions will be based at IGB Berlin, IGB Neuglobsow, and at the Berlin Centre for Genomics in Biodiversity Research. The institutes of the Leibniz Association strive to increase the proportion of female scientists. Therefore, female candidates are specifically encouraged to apply. Disabled applicants with identical technical and personal qualification will be preferentially selected.</p>

<p>Please submit a curriculum vitae (including publication list), a brief statement of motivation and research interests, and the names and contact information of two referees. Please send all documents as a single pdf file to monaghan@igb-berlin.de. </p>

<p>Review of the applications will start on 21 February 2014 and continue until the positions are filled. Interviews for shortlisted applicants will take place in March.</p>

<p>Biodiversity, Ecology, and Genomics of Aquatic Fungi<br />Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), Berlin, Germany</p>

<p>Deadline for applications : unknown.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8122/internships-indian-institute-of-science</guid>
  <pubDate>Sun, 02 Feb 2014 03:05:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[Internships @ Indian Institute of Science]]></title>
  <description><![CDATA[
<p>Internships available for Bachelors and Masters students</p>

<p>Each node will host student interns interested in pursuing a research career in mathematical or computational biology at institutions located in its region.</p>

<p>Eligibility: Bachelors (3rd or 4th year) and Masters students</p>

<p>Average duration: 3 months (could be more in certain cases). These internships can be availed at any time during 2014 subject to consent from the faculty mentor.</p>

<p>Fellowship amount: Rs. 10,000 per month. In addition, outstation interns can receive up to Rs. 5000 per month for accommodation and Rs. 3000 for travel from and to their home place.</p>

<p>Application procedure: Apply online at http://nnmcb.appzone.co.in/</p>

<p>Deadline: February 10, 2014</p>

<p>Contact Information:</p>

<p>National Network for Mathematical and Computational Biology</p>

<p>Department of Mathematics</p>

<p>Indian Institute of Science</p>

<p>Bangalore 560 012</p>

<p>Tel: 080-2293 2893</p>

<p>Email: nnmcb@math.iisc.ernet.in</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8520/rcb-gurgaon-bioinformatics-rapa-openings</guid>
  <pubDate>Thu, 27 Feb 2014 08:42:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[RCB Gurgaon Bioinformatics RA/PA Openings]]></title>
  <description><![CDATA[
<p>Advt. No.1/2014</p>

<p>Recruitment for Research Associate and Project Assistant positions</p>

<p>Regional Centre for Biotechnology (RCB) is an autonomous academic institution established by the Department of Biotechnology, Govt. of India with regional and global partnerships synergizing with the programmes of UNESCO as a Category II Centre. The primary focus of RCB is to provide world class education, training and conduct innovative research at the interface of multiple disciplines to create high quality human resource in disciplinary and interdisciplinary areas of biotechnology in a globally competitive research milieu. </p>

<p>Research Associate (02 Position)</p>

<p>Consolidated emoluments Rs.22000/- + 30% H.R.A. p.m.</p>

<p>Essential: Ph.D. in Natural Sciences, minimum 60% marks in all qualifying exams and below 35 years of age.</p>

<p>Desirable: Prior experience at the PhD level in Biochemistry, Bioinformatics and Proteomics with a strong motivation for a career in research is highly desirable.</p>

<p>Strong PhD level training with proteins chemistry, protein purification and statistical analysis of proteomics or genomics dataset will be preferred. Either/ both qualifications should be substantiated by published papers.</p>

<p>Inter-Institutional Program for  Maternal, Neonatal and Infant  Sciences: A translational approach to studying preterm birth. </p>

<p>Principal Investigator: Dr. Dinakar M. Salunke </p>

<p>Applicants may apply along with the requisite documents (attested copies) pertaining to proof of date of birth, academic/professional qualifications, experience (if any), in the prescribed format available on our websites: www.rcb.res.in and www.rcb.ac.in. Applications should be sent to the Registrar, Regional Centre for Biotechnology, 180 Udyog Vihar Phase 1, Gurgaon-122016, Haryana, India, through Registered Post on or before Feb 28, 2014. A soft copy of the application should be sent by email to registrar@rcb.res.in. Incomplete applications or applications received after Feb 28, 2014 will not be entertained. </p>

<p>More at https://www.rcb.res.in/Advt-1._for_websites_PTB-revised.pdf</p>
]]></description>
</item>

</channel>
</rss>