<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27090?offset=840</link>
	<atom:link href="https://bioinformaticsonline.com/related/27090?offset=840" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44641/heliano-a-fast-and-accurate-tool-for-detection-of-helitron-like-elements</guid>
	<pubDate>Tue, 13 Aug 2024 07:16:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44641/heliano-a-fast-and-accurate-tool-for-detection-of-helitron-like-elements</link>
	<title><![CDATA[HELIANO: A fast and accurate tool for detection of Helitron-like elements]]></title>
	<description><![CDATA[<p><span>Helitron-like elements (HLE1 and HLE2) are DNA transposons. They have been found in diverse species and seem to play significant roles in the evolution of host genomes. Although known for over twenty years, Helitron sequences are still challenging to identify. Here, we propose HELIANO (Helitron-like elements annotator) as an efficient solution for detecting Helitron-like elements.</span></p>
<p>https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkae679/7730539?login=true</p><p>Address of the bookmark: <a href="https://github.com/Zhenlisme/heliano/" rel="nofollow">https://github.com/Zhenlisme/heliano/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/45177/installing-crossroad-on-ubuntu</guid>
	<pubDate>Fri, 29 May 2026 05:19:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/45177/installing-crossroad-on-ubuntu</link>
	<title><![CDATA[Installing croSSRoad on Ubuntu !]]></title>
	<description><![CDATA[<p><strong>(base) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ conda</strong><br />usage: conda [-h] [-v] [--no-plugins] [-V] COMMAND ...</p><p>conda is a tool for managing and deploying applications, environments and packages.</p><p>options:<br /> -h, --help Show this help message and exit.<br /> -v, --verbose Can be used multiple times. Once for detailed output, twice for INFO logging, thrice for DEBUG logging, four times for TRACE logging.<br /> --no-plugins Disable all plugins that are not built into conda.<br /> -V, --version Show the conda version number and exit.</p><p>commands:<br /> The following built-in and plugins subcommands are available.</p><p>COMMAND<br /> activate Activate a conda environment.<br /> clean Remove unused packages and caches.<br /> commands List all available conda subcommands (including those from plugins). Generally only used by tab-completion.<br /> compare Compare packages between conda environments.<br /> config Modify configuration values in .condarc.<br /> create Create a new conda environment from a list of specified packages.<br /> deactivate Deactivate the current active conda environment.<br /> doctor Display a health report for your environment.<br /> env Create and manage conda environments.<br /> export Export a given environment<br /> info Display information about current conda install.<br /> init Initialize conda for shell interaction.<br /> install Install a list of packages into a specified conda environment.<br /> list List installed packages in a conda environment.<br /> notices Retrieve latest channel notifications.<br /> package Create low-level conda packages. (EXPERIMENTAL)<br /> remove (uninstall) Remove a list of packages from a specified conda environment.<br /> rename Rename an existing environment.<br /> repoquery Advanced search for repodata.<br /> run Run an executable in a conda environment.<br /> search Search for packages and display associated information using the MatchSpec format.<br /> update (upgrade) Update conda packages to the latest compatible version.<br />(base) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ conda create -n jitENV<br />Retrieving notices: done<br />Channels:<br /> - ursky<br /> - bioconda<br /> - conda-forge<br />Platform: linux-64<br />Collecting package metadata (repodata.json): done<br />Solving environment: done</p><p><br />==&gt; WARNING: A newer version of conda exists. &lt;==<br /> current version: 25.7.0<br /> latest version: 26.5.0</p><p>Please update conda by running</p><p>$ conda update -n base -c conda-forge conda</p><p>&nbsp;</p><p>## Package Plan ##</p><p>environment location: /home/hp/miniforge3/envs/jitENV</p><p>&nbsp;</p><p>Proceed ([y]/n)? y</p><p><br />Downloading and Extracting Packages:</p><p>Preparing transaction: done<br />Verifying transaction: done<br />Executing transaction: done<br />#<br /># To activate this environment, use<br />#<br /># $ conda activate jitENV<br />#<br /># To deactivate an active environment, use<br />#<br /># $ conda deactivate</p><p><strong>(base) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ conda activate jitENV</strong><br /><strong>(jitENV) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ conda install conda-forge::mamba</strong><br />Channels:<br /> - ursky<br /> - bioconda<br /> - conda-forge<br />Platform: linux-64<br />Collecting package metadata (repodata.json): done<br />Solving environment: done</p><p><br />==&gt; WARNING: A newer version of conda exists. &lt;==<br /> current version: 25.7.0<br /> latest version: 26.5.0</p><p>Please update conda by running</p><p>$ conda update -n base -c conda-forge conda</p><p>&nbsp;</p><p>## Package Plan ##</p><p>environment location: /home/hp/miniforge3/envs/jitENV</p><p>added / updated specs:<br /> - conda-forge::mamba</p><p><br />The following packages will be downloaded:</p><p>package | build<br /> ---------------------------|-----------------<br /> ca-certificates-2026.5.20 | hbd8a1cb_0 127 KB conda-forge<br /> cpp-expected-1.3.1 | h171cf75_0 24 KB conda-forge<br /> fmt-12.1.0 | hff5e90c_0 193 KB conda-forge<br /> libarchive-3.8.7 | gpl_hc2c16d8_101 869 KB conda-forge<br /> libcurl-8.20.0 | hcf29cc6_0 458 KB conda-forge<br /> libgcc-15.2.0 | he0feb66_19 1017 KB conda-forge<br /> libgcc-ng-15.2.0 | h69a702a_19 27 KB conda-forge<br /> libgomp-15.2.0 | he0feb66_19 590 KB conda-forge<br /> libmamba-2.6.2 | hd28c85e_0 2.7 MB conda-forge<br /> libmsgpack-c-6.1.0 | h54a6638_6 39 KB conda-forge<br /> libsolv-0.7.38 | h9463b59_0 509 KB conda-forge<br /> libstdcxx-15.2.0 | h934c35e_19 5.6 MB conda-forge<br /> libxml2-2.15.3 | h49c6c72_0 46 KB conda-forge<br /> libxml2-16-2.15.3 | hca6bf5a_0 547 KB conda-forge<br /> mamba-2.6.2 | hce6dcdd_0 553 KB conda-forge<br /> ncurses-6.6 | hdb14827_0 897 KB conda-forge<br /> nlohmann_json-abi-3.12.0 | h0f90c79_1 4 KB conda-forge<br /> reproc-14.2.7.post0 | hb03c661_1 35 KB conda-forge<br /> reproc-cpp-14.2.7.post0 | hecca717_1 26 KB conda-forge<br /> simdjson-4.6.4 | hb700be7_0 310 KB conda-forge<br /> spdlog-1.17.0 | hab81395_1 192 KB conda-forge<br /> ------------------------------------------------------------<br /> Total: 14.6 MB</p><p>The following NEW packages will be INSTALLED:</p><p>_openmp_mutex conda-forge/linux-64::_openmp_mutex-4.5-20_gnu <br /> bzip2 conda-forge/linux-64::bzip2-1.0.8-hda65f42_9 <br /> c-ares conda-forge/linux-64::c-ares-1.34.6-hb03c661_0 <br /> ca-certificates conda-forge/noarch::ca-certificates-2026.5.20-hbd8a1cb_0 <br /> cpp-expected conda-forge/linux-64::cpp-expected-1.3.1-h171cf75_0 <br /> fmt conda-forge/linux-64::fmt-12.1.0-hff5e90c_0 <br /> icu conda-forge/linux-64::icu-78.3-h33c6efd_0 <br /> keyutils conda-forge/linux-64::keyutils-1.6.3-hb9d3cd8_0 <br /> krb5 conda-forge/linux-64::krb5-1.22.2-ha1258a1_0 <br /> libarchive conda-forge/linux-64::libarchive-3.8.7-gpl_hc2c16d8_101 <br /> libcurl conda-forge/linux-64::libcurl-8.20.0-hcf29cc6_0 <br /> libedit conda-forge/linux-64::libedit-3.1.20250104-pl5321h7949ede_0 <br /> libev conda-forge/linux-64::libev-4.33-hd590300_2 <br /> libgcc conda-forge/linux-64::libgcc-15.2.0-he0feb66_19 <br /> libgcc-ng conda-forge/linux-64::libgcc-ng-15.2.0-h69a702a_19 <br /> libgomp conda-forge/linux-64::libgomp-15.2.0-he0feb66_19 <br /> libiconv conda-forge/linux-64::libiconv-1.18-h3b78370_2 <br /> liblzma conda-forge/linux-64::liblzma-5.8.3-hb03c661_0 <br /> libmamba conda-forge/linux-64::libmamba-2.6.2-hd28c85e_0 <br /> libmsgpack-c conda-forge/linux-64::libmsgpack-c-6.1.0-h54a6638_6 <br /> libnghttp2 conda-forge/linux-64::libnghttp2-1.68.1-h877daf1_0 <br /> libsolv conda-forge/linux-64::libsolv-0.7.38-h9463b59_0 <br /> libssh2 conda-forge/linux-64::libssh2-1.11.1-hcf80075_0 <br /> libstdcxx conda-forge/linux-64::libstdcxx-15.2.0-h934c35e_19 <br /> libxml2 conda-forge/linux-64::libxml2-2.15.3-h49c6c72_0 <br /> libxml2-16 conda-forge/linux-64::libxml2-16-2.15.3-hca6bf5a_0 <br /> libzlib conda-forge/linux-64::libzlib-1.3.2-h25fd6f3_2 <br /> lz4-c conda-forge/linux-64::lz4-c-1.10.0-h5888daf_1 <br /> lzo conda-forge/linux-64::lzo-2.10-h280c20c_1002 <br /> mamba conda-forge/linux-64::mamba-2.6.2-hce6dcdd_0 <br /> ncurses conda-forge/linux-64::ncurses-6.6-hdb14827_0 <br /> nlohmann_json-abi conda-forge/noarch::nlohmann_json-abi-3.12.0-h0f90c79_1 <br /> openssl conda-forge/linux-64::openssl-3.6.2-h35e630c_0 <br /> reproc conda-forge/linux-64::reproc-14.2.7.post0-hb03c661_1 <br /> reproc-cpp conda-forge/linux-64::reproc-cpp-14.2.7.post0-hecca717_1 <br /> simdjson conda-forge/linux-64::simdjson-4.6.4-hb700be7_0 <br /> spdlog conda-forge/linux-64::spdlog-1.17.0-hab81395_1 <br /> yaml-cpp conda-forge/linux-64::yaml-cpp-0.8.0-h3f2d84a_0 <br /> zstd conda-forge/linux-64::zstd-1.5.7-hb78ec9c_6</p><p><br />Proceed ([y]/n)? y</p><p><br />Downloading and Extracting Packages:<br /> <br />Preparing transaction: done <br />Verifying transaction: done <br />Executing transaction: done <br />(jitENV) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ mamba install -c jitendralab -c bioconda -c conda-forge crossroad -y <br />jitendralab/noarch ??.?MB @ ??.?MB/s 0.3s<br />jitendralab/linux-64 ??.?MB @ ??.?MB/s 0.4s<br />bioconda/linux-64 5.6MB @ 2.9MB/s 1.9s<br />bioconda/noarch 5.6MB @ 2.5MB/s 2.2s<br />conda-forge/noarch 26.4MB @ 6.0MB/s 4.5s<br />conda-forge/linux-64 53.8MB @ 6.7MB/s 8.2s</p><p><br />Transaction <br /> <br /> Prefix: /home/hp/miniforge3/envs/jitENV <br /> <br /> Updating specs: <br /> <br /> - crossroad</p><p>Package Version Build Channel Size<br />─────────────────────────────────────────────────────────────────────────────────────────────────<br /> Install:<br />─────────────────────────────────────────────────────────────────────────────────────────────────</p><p>+ annotated-doc 0.0.4 pyhcf101f3_0 conda-forge Cached<br /> + annotated-types 0.7.0 pyhd8ed1ab_1 conda-forge Cached<br /> + anyio 4.13.0 pyhcf101f3_0 conda-forge 147kB<br /> + argcomplete 3.6.3 pyhd8ed1ab_0 conda-forge Cached<br /> + aws-c-auth 0.10.3 h3aafcba_1 conda-forge 134kB<br /> + aws-c-cal 0.9.14 h8e43964_1 conda-forge 57kB<br /> + aws-c-common 0.13.1 hb03c661_0 conda-forge 242kB<br /> + aws-c-compression 0.3.2 h16e98cb_1 conda-forge 22kB<br /> + aws-c-event-stream 0.7.1 h9be7a74_1 conda-forge 59kB<br /> + aws-c-http 0.11.0 hcbcd92d_1 conda-forge 230kB<br /> + aws-c-io 0.26.3 h955231c_3 conda-forge 182kB<br /> + aws-c-mqtt 0.15.2 h8af55cf_3 conda-forge 222kB<br /> + aws-c-s3 0.12.3 h00bea6e_2 conda-forge 153kB<br /> + aws-c-sdkutils 0.2.4 h16e98cb_5 conda-forge 59kB<br /> + aws-checksums 0.2.10 h16e98cb_1 conda-forge 102kB<br /> + aws-crt-cpp 0.38.3 h7b0d4b4_2 conda-forge 413kB<br /> + aws-sdk-cpp 1.11.747 h5a171d8_5 conda-forge 4MB<br /> + azure-core-cpp 1.16.2 h206d751_0 conda-forge 349kB<br /> + azure-identity-cpp 1.13.3 hed0cdb0_1 conda-forge 251kB<br /> + azure-storage-blobs-cpp 12.17.0 hf824e48_1 conda-forge 587kB<br /> + azure-storage-common-cpp 12.13.0 ha7a2c86_0 conda-forge 159kB<br /> + azure-storage-files-datalake-cpp 12.15.0 h1e5b466_0 conda-forge 304kB<br /> + backports.zstd 1.5.0 py314h680f03e_0 conda-forge 8kB<br /> + bedtools 2.31.1 h13024bc_3 bioconda Cached<br /> + biopython 1.87 py314h5bd0f2a_0 conda-forge 3MB<br /> + brotli 1.2.0 hed03a55_1 conda-forge Cached<br /> + brotli-bin 1.2.0 hb03c661_1 conda-forge Cached<br /> + brotli-python 1.2.0 py314h3de4e8d_1 conda-forge 367kB<br /> + certifi 2026.5.20 pyhd8ed1ab_0 conda-forge 134kB<br /> + charset-normalizer 3.4.7 pyhd8ed1ab_0 conda-forge Cached<br /> + click 8.4.1 pyhc90fa1f_0 conda-forge 105kB<br /> + colorama 0.4.6 pyhd8ed1ab_1 conda-forge Cached<br /> + contourpy 1.3.3 py314h97ea11e_4 conda-forge 324kB<br /> + crossroad 0.3.6 pyh7e60211_0 jitendralab 2MB<br /> + cycler 0.12.1 pyhcf101f3_2 conda-forge Cached<br /> + dnspython 2.8.0 pyhcf101f3_0 conda-forge Cached<br /> + email-validator 2.3.0 pyhd8ed1ab_0 conda-forge 47kB<br /> + email_validator 2.3.0 hd8ed1ab_0 conda-forge 7kB<br /> + exceptiongroup 1.3.1 pyhd8ed1ab_0 conda-forge Cached<br /> + expat 2.8.1 hecca717_0 conda-forge 148kB<br /> + fastapi 0.136.3 h5ddb490_0 conda-forge 5kB<br /> + fastapi-cli 0.0.23 pyhcf101f3_0 conda-forge 19kB<br /> + fastapi-core 0.136.3 pyhcf101f3_0 conda-forge 96kB<br /> + fastar 0.11.0 py314h0b738fb_0 conda-forge 423kB<br /> + font-ttf-dejavu-sans-mono 2.37 hab24e00_0 conda-forge Cached<br /> + font-ttf-inconsolata 3.000 h77eed37_0 conda-forge Cached<br /> + font-ttf-source-code-pro 2.038 h77eed37_0 conda-forge Cached<br /> + font-ttf-ubuntu 0.83 h77eed37_3 conda-forge Cached<br /> + fontconfig 2.18.0 h27c8c51_0 conda-forge 281kB<br /> + fonts-conda-forge 1 hc364b38_1 conda-forge Cached<br /> + fonttools 4.63.0 pyh7db6752_0 conda-forge 846kB<br /> + freetype 2.14.3 ha770c72_0 conda-forge Cached<br /> + gflags 2.2.2 h5888daf_1005 conda-forge 120kB<br /> + glog 0.7.1 hbabe93e_0 conda-forge 143kB<br /> + h11 0.16.0 pyhcf101f3_1 conda-forge 39kB<br /> + h2 4.3.0 pyhcf101f3_0 conda-forge Cached<br /> + hpack 4.1.0 pyhd8ed1ab_0 conda-forge Cached<br /> + httpcore 1.0.9 pyh29332c3_0 conda-forge Cached<br /> + httptools 0.7.1 py314h5bd0f2a_1 conda-forge 99kB<br /> + httpx 0.28.1 pyhd8ed1ab_0 conda-forge Cached<br /> + hyperframe 6.1.0 pyhd8ed1ab_0 conda-forge Cached<br /> + idna 3.17 pyhcf101f3_0 conda-forge 57kB<br /> + jinja2 3.1.6 pyhcf101f3_1 conda-forge Cached<br /> + kaleido-core 0.2.1 h3644ca4_0 conda-forge Cached<br /> + kiwisolver 1.5.0 py314h97ea11e_0 conda-forge 77kB<br /> + lcms2 2.19.1 h0c24ade_0 conda-forge 251kB<br /> + ld_impl_linux-64 2.45.1 default_hbd61a6d_102 conda-forge Cached<br /> + lerc 4.1.0 hdb68285_0 conda-forge Cached<br /> + libabseil 20260107.1 cxx17_h7b12aa8_0 conda-forge 1MB<br /> + libarrow 24.0.0 h6f10b76_3_cpu conda-forge 7MB<br /> + libarrow-acero 24.0.0 h635bf11_3_cpu conda-forge 592kB<br /> + libarrow-compute 24.0.0 h53684a4_3_cpu conda-forge 3MB<br /> + libarrow-dataset 24.0.0 h635bf11_3_cpu conda-forge 592kB<br /> + libarrow-substrait 24.0.0 hb4dd7c2_3_cpu conda-forge 502kB<br /> + libblas 3.11.0 8_h4a7cf45_openblas conda-forge 19kB<br /> + libbrotlicommon 1.2.0 hb03c661_1 conda-forge Cached<br /> + libbrotlidec 1.2.0 hb03c661_1 conda-forge Cached<br /> + libbrotlienc 1.2.0 hb03c661_1 conda-forge Cached<br /> + libcblas 3.11.0 8_h0358290_openblas conda-forge 19kB<br /> + libcrc32c 1.1.2 h9c3ff4c_0 conda-forge Cached<br /> + libdeflate 1.25 h17f619e_0 conda-forge Cached<br /> + libevent 2.1.12 hf998b51_1 conda-forge Cached<br /> + libexpat 2.8.1 hecca717_0 conda-forge 77kB<br /> + libffi 3.5.2 h3435931_0 conda-forge Cached<br /> + libfreetype 2.14.3 ha770c72_0 conda-forge Cached<br /> + libfreetype6 2.14.3 h73754d4_0 conda-forge Cached<br /> + libgfortran 15.2.0 h69a702a_19 conda-forge 28kB<br /> + libgfortran5 15.2.0 h68bc16d_19 conda-forge 2MB<br /> + libgoogle-cloud 3.5.0 h25dbb67_0 conda-forge 3MB<br /> + libgoogle-cloud-storage 3.5.0 hdbdcf42_0 conda-forge 780kB<br /> + libgrpc 1.78.1 h1d1128b_0 conda-forge 7MB<br /> + libjpeg-turbo 3.1.4.1 hb03c661_0 conda-forge Cached<br /> + liblapack 3.11.0 8_h47877c9_openblas conda-forge 19kB<br /> + libmpdec 4.0.0 hb03c661_1 conda-forge 92kB<br /> + libopenblas 0.3.33 pthreads_h94d23a6_0 conda-forge 6MB<br /> + libopentelemetry-cpp 1.26.0 h9692893_0 conda-forge 934kB<br /> + libopentelemetry-cpp-headers 1.26.0 ha770c72_0 conda-forge 396kB<br /> + libparquet 24.0.0 h7376487_3_cpu conda-forge 1MB<br /> + libpng 1.6.58 h421ea60_0 conda-forge 318kB<br /> + libprotobuf 6.33.5 h6eeba95_1 conda-forge 4MB<br /> + libre2-11 2025.11.05 h0dc7533_1 conda-forge 213kB<br /> + libsqlite 3.53.1 h0c1763c_0 conda-forge 955kB<br /> + libstdcxx-ng 15.2.0 hdf11a46_19 conda-forge 28kB<br /> + libthrift 0.22.0 h7d032f7_2 conda-forge 424kB<br /> + libtiff 4.7.1 h9d88235_1 conda-forge Cached<br /> + libutf8proc 2.11.3 hfe17d71_0 conda-forge 86kB<br /> + libuuid 2.42.1 h5347b49_0 conda-forge 40kB<br /> + libuv 1.52.1 h280c20c_0 conda-forge 420kB<br /> + libwebp-base 1.6.0 hd42ef1d_0 conda-forge Cached<br /> + libxcb 1.17.0 h8a09558_0 conda-forge Cached<br /> + markdown-it-py 4.2.0 pyhd8ed1ab_0 conda-forge 69kB<br /> + markupsafe 3.0.3 py314h67df5f8_1 conda-forge 27kB<br /> + mathjax 2.7.7 ha770c72_3 conda-forge Cached<br /> + matplotlib-base 3.10.9 py314h1194b4b_0 conda-forge 9MB<br /> + mdurl 0.1.2 pyhd8ed1ab_1 conda-forge Cached<br /> + munkres 1.0.7 py_1 bioconda Cached<br /> + narwhals 2.21.2 pyhcf101f3_0 conda-forge 284kB<br /> + nlohmann_json 3.12.0 h54a6638_1 conda-forge 136kB<br /> + nspr 4.38 h29cc59b_0 conda-forge Cached<br /> + nss 3.118 h445c969_0 conda-forge Cached<br /> + numpy 2.4.6 py314h2b28147_0 conda-forge 9MB<br /> + openjpeg 2.5.4 h55fea9a_0 conda-forge Cached<br /> + orc 2.3.0 h21090e2_0 conda-forge 1MB<br /> + packaging 26.2 pyhc364b38_0 conda-forge 92kB<br /> + pandas 3.0.3 py314hb4ffadd_0 conda-forge 15MB<br /> + perf_ssr 0.4.8 py_0 jitendralab 720kB<br /> + pillow 12.2.0 py314h8ec4b1a_0 conda-forge 1MB<br /> + pip 26.1.1 pyh145f28c_0 conda-forge 1MB<br /> + plotly 6.6.0 pyhd8ed1ab_0 conda-forge Cached<br /> + plotly-upset-hd 0.0.2 py_0 jitendralab 356kB<br /> + prometheus-cpp 1.3.0 ha5d0236_0 conda-forge 200kB<br /> + pthread-stubs 0.4 hb9d3cd8_1002 conda-forge Cached<br /> + pyarrow 24.0.0 py314hdafbbf9_0 conda-forge 27kB<br /> + pyarrow-core 24.0.0 py314h969be7f_0_cpu conda-forge 5MB<br /> + pydantic 2.13.4 pyhcf101f3_0 conda-forge 347kB<br /> + pydantic-core 2.46.4 py314h2e6c369_0 conda-forge 2MB<br /> + pydantic-extra-types 2.11.2 pyhcf101f3_0 conda-forge 74kB<br /> + pydantic-settings 2.14.1 pyhcf101f3_0 conda-forge 52kB<br /> + pygments 2.20.0 pyhd8ed1ab_0 conda-forge Cached<br /> + pyparsing 3.3.2 pyhcf101f3_0 conda-forge Cached<br /> + pysocks 1.7.1 pyha55dd90_7 conda-forge Cached<br /> + python 3.14.5 habeac84_100_cp314 conda-forge 37MB<br /> + python-dateutil 2.9.0.post0 pyhe01879c_2 conda-forge Cached<br /> + python-dotenv 1.2.2 pyhcf101f3_0 conda-forge Cached<br /> + python-kaleido 0.2.1 pyhd8ed1ab_0 conda-forge Cached<br /> + python-multipart 0.0.29 pyhcf101f3_0 conda-forge 38kB<br /> + python_abi 3.14 8_cp314 conda-forge 7kB<br /> + pyyaml 6.0.3 py314h67df5f8_1 conda-forge 202kB<br /> + qhull 2020.2 h434a139_5 conda-forge Cached<br /> + re2 2025.11.05 h5301d42_1 conda-forge 27kB<br /> + readline 8.3 h853b02a_0 conda-forge Cached<br /> + requests 2.34.2 pyhcf101f3_0 conda-forge 69kB<br /> + rich 15.0.0 pyhcf101f3_0 conda-forge Cached<br /> + rich-argparse 1.8.0 pyhd8ed1ab_0 conda-forge 27kB<br /> + rich-click 1.9.8 pyh8f84b5b_0 conda-forge 64kB<br /> + rich-toolkit 0.19.10 pyhcf101f3_0 conda-forge 33kB<br /> + s2n 1.7.3 hc5a330e_0 conda-forge 388kB<br /> + seqkit 2.13.0 he881be0_0 bioconda Cached<br /> + seqtk 1.5 h577a1d6_1 bioconda 142kB<br /> + shellingham 1.5.4 pyhd8ed1ab_2 conda-forge Cached<br /> + six 1.17.0 pyhe01879c_1 conda-forge Cached<br /> + snappy 1.2.2 h03e3b7b_1 conda-forge Cached<br /> + sniffio 1.3.1 pyhd8ed1ab_2 conda-forge Cached<br /> + sqlite 3.53.1 hbc0de68_0 conda-forge 205kB<br /> + starlette 1.1.0 pyhcf101f3_0 conda-forge 64kB<br /> + tk 8.6.13 noxft_h366c992_103 conda-forge Cached<br /> + tomli 2.4.1 pyhcf101f3_0 conda-forge 22kB<br /> + tqdm 4.67.3 pyh8f84b5b_0 conda-forge Cached<br /> + typer 0.26.3 pyhcf101f3_0 conda-forge 184kB<br /> + typing-extensions 4.15.0 h396c80c_0 conda-forge Cached<br /> + typing-inspection 0.4.2 pyhcf101f3_2 conda-forge 21kB<br /> + typing_extensions 4.15.0 pyhcf101f3_0 conda-forge Cached<br /> + tzdata 2025c hc9c84f9_1 conda-forge Cached<br /> + unicodedata2 17.0.1 py314h5bd0f2a_0 conda-forge 410kB<br /> + upsetplot 0.9.0 pyhd8ed1ab_1 conda-forge 28kB<br /> + urllib3 2.7.0 pyhd8ed1ab_0 conda-forge 104kB<br /> + uvicorn 0.48.0 pyhc90fa1f_0 conda-forge 56kB<br /> + uvicorn-standard 0.48.0 he364bde_0 conda-forge 4kB<br /> + uvloop 0.22.1 py314h5bd0f2a_1 conda-forge 593kB<br /> + watchfiles 1.2.0 py314ha5689aa_0 conda-forge 416kB<br /> + websockets 16.0 py314h0f05182_1 conda-forge 383kB<br /> + xorg-libxau 1.0.12 hb03c661_1 conda-forge Cached<br /> + xorg-libxdmcp 1.1.5 hb03c661_1 conda-forge Cached<br /> + yaml 0.2.5 h280c20c_3 conda-forge Cached<br /> + zlib 1.3.2 h25fd6f3_2 conda-forge Cached<br /> + zlib-ng 2.3.3 hceb46e0_1 conda-forge Cached</p><p>Summary:</p><p>Install: 186 packages</p><p>Total download: 142MB</p><p>─────────────────────────────────────────────────────────────────────────────────────────────────</p><p>&nbsp;</p><p>Transaction starting<br />libgrpc 7.0MB @ 2.3MB/s 3.0s<br />numpy 8.9MB @ 2.3MB/s 3.8s<br />matplotlib-base 8.5MB @ 2.0MB/s 4.2s<br />libarrow 6.5MB @ 2.3MB/s 2.8s<br />pandas 15.3MB @ 2.5MB/s 6.2s<br />libopenblas 5.9MB @ 2.3MB/s 2.5s<br />pyarrow-core 4.8MB @ 1.6MB/s 3.0s<br />libprotobuf 3.7MB @ 2.4MB/s 1.6s<br />aws-sdk-cpp 3.6MB @ 3.1MB/s 1.2s<br />biopython 3.4MB @ 2.0MB/s 1.7s<br />libgfortran5 2.5MB @ 2.6MB/s 1.0s<br />libgoogle-cloud 2.6MB @ 2.4MB/s 1.1s<br />pydantic-core 1.9MB @ 2.7MB/s 0.7s<br />libarrow-compute 3.0MB @ 1.9MB/s 1.6s<br />orc 1.5MB @ 2.8MB/s 0.5s<br />libparquet 1.4MB @ 3.1MB/s 0.5s<br />pip 1.2MB @ 2.9MB/s 0.4s<br />libabseil 1.4MB @ 2.2MB/s 0.6s<br />pillow 1.1MB @ 2.7MB/s 0.4s<br />libsqlite 955.0kB @ 2.9MB/s 0.3s<br />libgoogle-cloud-storage 779.6kB @ 2.7MB/s 0.3s<br />fonttools 846.0kB @ 2.1MB/s 0.4s<br />libopentelemetry-cpp 934.3kB @ 1.8MB/s 0.5s<br />libarrow-acero 592.3kB @ 2.2MB/s 0.2s<br />uvloop 593.4kB @ 1.3MB/s 0.4s<br />libarrow-dataset 592.2kB @ 2.7MB/s 0.2s<br />libarrow-substrait 501.9kB @ 1.8MB/s 0.2s<br />azure-storage-blobs-cpp 587.1kB @ 1.6MB/s 0.3s<br />libthrift 423.9kB @ 2.8MB/s 0.2s<br />crossroad 1.8MB @ 663.3kB/s 2.6s<br />libuv 419.9kB @ 2.3MB/s 0.2s<br />fastar 423.4kB @ 966.7kB/s 0.3s<br />aws-crt-cpp 412.5kB @ 2.9MB/s 0.1s<br />watchfiles 415.6kB @ 1.6MB/s 0.3s<br />unicodedata2 409.6kB @ 1.8MB/s 0.2s<br />libopentelemetry-cpp-headers 396.4kB @ 2.2MB/s 0.2s<br />s2n 388.1kB @ 2.5MB/s 0.1s<br />brotli-python 367.4kB @ 1.7MB/s 0.1s<br />websockets 383.0kB @ 1.3MB/s 0.3s<br />azure-core-cpp 348.7kB @ 2.7MB/s 0.1s<br />pydantic 346.5kB @ 1.9MB/s 0.2s<br />contourpy 324.0kB @ 2.3MB/s 0.1s<br />libpng 317.7kB @ 1.8MB/s 0.2s<br />azure-storage-files-datalake-cpp 303.8kB @ 1.9MB/s 0.1s<br />narwhals 284.3kB @ 1.8MB/s 0.2s<br />fontconfig 280.9kB @ 866.6kB/s 0.2s<br />python 36.7MB @ 3.0MB/s 12.0s<br />azure-identity-cpp 250.5kB @ 1.5MB/s 0.1s<br />lcms2 251.1kB @ 2.0MB/s 0.1s<br />aws-c-common 242.3kB @ 2.8MB/s 0.1s<br />libre2-11 213.1kB @ 66.4kB/s 0.1s<br />aws-c-http 230.3kB @ 1.7MB/s 0.1s<br />aws-c-mqtt 221.7kB @ 307.2kB/s 0.1s<br />sqlite 205.4kB @ ??.?MB/s 0.1s<br />perf_ssr 720.0kB @ 247.3kB/s 2.3s<br />prometheus-cpp 199.5kB @ 962.8kB/s 0.1s<br />pyyaml 202.4kB @ 1.6MB/s 0.1s<br />typer 184.4kB @ 1.9MB/s 0.1s<br />aws-c-io 181.6kB @ 1.9MB/s 0.1s<br />aws-c-s3 153.0kB @ 2.2MB/s 0.1s<br />azure-storage-common-cpp 159.1kB @ 1.8MB/s 0.1s<br />expat 148.2kB @ ??.?MB/s 0.0s<br />anyio 146.8kB @ 2.2MB/s 0.1s<br />glog 143.5kB @ 2.6MB/s 0.1s<br />seqtk 141.8kB @ 1.8MB/s 0.1s<br />nlohmann_json 136.2kB @ 2.1MB/s 0.1s<br />aws-c-auth 134.4kB @ 1.5MB/s 0.1s<br />certifi 134.2kB @ 1.8MB/s 0.1s<br />click 105.0kB @ 1.5MB/s 0.1s<br />gflags 119.7kB @ 148.2kB/s 0.1s<br />urllib3 103.6kB @ ??.?MB/s 0.0s<br />aws-checksums 101.6kB @ ??.?MB/s 0.0s<br />fastapi-core 95.5kB @ ??.?MB/s 0.0s<br />libmpdec 92.4kB @ ??.?MB/s 0.0s<br />packaging 91.6kB @ ??.?MB/s 0.0s<br />libutf8proc 86.0kB @ ??.?MB/s 0.0s<br />kiwisolver 77.4kB @ ??.?MB/s 0.0s<br />libexpat 77.3kB @ 885.4kB/s 0.1s<br />pydantic-extra-types 73.9kB @ ??.?MB/s 0.0s<br />markdown-it-py 69.0kB @ ??.?MB/s 0.0s<br />requests 68.7kB @ ??.?MB/s 0.0s<br />rich-click 64.4kB @ ??.?MB/s 0.0s<br />aws-c-event-stream 59.3kB @ ??.?MB/s 0.0s<br />starlette 63.7kB @ ??.?MB/s 0.0s<br />aws-c-sdkutils 59.1kB @ ??.?MB/s 0.0s<br />aws-c-cal 56.9kB @ ??.?MB/s 0.0s<br />idna 56.9kB @ ??.?MB/s 0.0s<br />uvicorn 56.3kB @ ??.?MB/s 0.0s<br />pydantic-settings 52.3kB @ ??.?MB/s 0.0s<br />email-validator 46.8kB @ ??.?MB/s 0.0s<br />libuuid 40.2kB @ ??.?MB/s 0.0s<br />h11 39.1kB @ ??.?MB/s 0.0s<br />python-multipart 37.8kB @ ??.?MB/s 0.0s<br />rich-toolkit 32.9kB @ ??.?MB/s 0.0s<br />upsetplot 28.0kB @ ??.?MB/s 0.0s<br />libstdcxx-ng 27.8kB @ ??.?MB/s 0.0s<br />libgfortran 27.7kB @ ??.?MB/s 0.0s<br />re2 27.5kB @ ??.?MB/s 0.0s<br />markupsafe 27.4kB @ ??.?MB/s 0.0s<br />pyarrow 26.8kB @ ??.?MB/s 0.0s<br />aws-c-compression 22.0kB @ ??.?MB/s 0.0s<br />tomli 21.6kB @ ??.?MB/s 0.0s<br />typing-inspection 20.9kB @ ??.?MB/s 0.0s<br />fastapi-cli 18.9kB @ ??.?MB/s 0.0s<br />libblas 18.8kB @ ??.?MB/s 0.0s<br />httptools 99.0kB @ ??.?MB/s 0.4s<br />liblapack 18.8kB @ ??.?MB/s 0.0s<br />libcblas 18.8kB @ ??.?MB/s 0.0s<br />email_validator 7.1kB @ ??.?MB/s 0.0s<br />backports.zstd 7.5kB @ ??.?MB/s 0.0s<br />python_abi 7.0kB @ ??.?MB/s 0.0s<br />fastapi 4.8kB @ ??.?MB/s 0.0s<br />uvicorn-standard 4.1kB @ ??.?MB/s 0.0s<br />rich-argparse 26.8kB @ ??.?MB/s 0.2s<br />plotly-upset-hd 356.0kB @ 181.5kB/s 1.8s<br />Linking seqkit-2.13.0-he881be0_0<br />Linking bedtools-2.31.1-h13024bc_3<br />Linking seqtk-1.5-h577a1d6_1<br />Linking libuuid-2.42.1-h5347b49_0<br />Linking readline-8.3-h853b02a_0<br />Linking libexpat-2.8.1-hecca717_0<br />Linking nspr-4.38-h29cc59b_0<br />Linking mathjax-2.7.7-ha770c72_3<br />Linking libuv-1.52.1-h280c20c_0<br />Linking yaml-0.2.5-h280c20c_3<br />Linking ld_impl_linux-64-2.45.1-default_hbd61a6d_102<br />Linking libmpdec-4.0.0-hb03c661_1<br />Linking libwebp-base-1.6.0-hd42ef1d_0<br />Linking zlib-ng-2.3.3-hceb46e0_1<br />Linking libstdcxx-ng-15.2.0-hdf11a46_19<br />Linking pthread-stubs-0.4-hb9d3cd8_1002<br />Linking xorg-libxau-1.0.12-hb03c661_1<br />Linking xorg-libxdmcp-1.1.5-hb03c661_1<br />Linking libgfortran5-15.2.0-h68bc16d_19<br />Linking libpng-1.6.58-h421ea60_0<br />Linking libbrotlicommon-1.2.0-hb03c661_1<br />Linking libjpeg-turbo-3.1.4.1-hb03c661_0<br />Linking libdeflate-1.25-h17f619e_0<br />Linking lerc-4.1.0-hdb68285_0<br />Linking libsqlite-3.53.1-h0c1763c_0<br />Linking libffi-3.5.2-h3435931_0<br />Linking tk-8.6.13-noxft_h366c992_103<br />Linking azure-core-cpp-1.16.2-h206d751_0<br />Linking libabseil-20260107.1-cxx17_h7b12aa8_0<br />Linking libutf8proc-2.11.3-hfe17d71_0<br />Linking libopentelemetry-cpp-headers-1.26.0-ha770c72_0<br />Linking zlib-1.3.2-h25fd6f3_2<br />Linking snappy-1.2.2-h03e3b7b_1<br />Linking nlohmann_json-3.12.0-h54a6638_1<br />Linking aws-c-common-0.13.1-hb03c661_0<br />Linking s2n-1.7.3-hc5a330e_0<br />Linking gflags-2.2.2-h5888daf_1005<br />Linking libevent-2.1.12-hf998b51_1<br />Linking expat-2.8.1-hecca717_0<br />Linking libcrc32c-1.1.2-h9c3ff4c_0<br />Linking qhull-2020.2-h434a139_5<br />Linking libxcb-1.17.0-h8a09558_0<br />Linking libgfortran-15.2.0-h69a702a_19<br />Linking libfreetype6-2.14.3-h73754d4_0<br />Linking libbrotlienc-1.2.0-hb03c661_1<br />Linking libbrotlidec-1.2.0-hb03c661_1<br />Linking libtiff-4.7.1-h9d88235_1<br />Linking sqlite-3.53.1-hbc0de68_0<br />Linking nss-3.118-h445c969_0<br />Linking azure-identity-cpp-1.13.3-hed0cdb0_1<br />Linking azure-storage-common-cpp-12.13.0-ha7a2c86_0<br />Linking libprotobuf-6.33.5-h6eeba95_1<br />Linking libre2-11-2025.11.05-h0dc7533_1<br />Linking prometheus-cpp-1.3.0-ha5d0236_0<br />Linking aws-c-compression-0.3.2-h16e98cb_1<br />Linking aws-checksums-0.2.10-h16e98cb_1<br />Linking aws-c-sdkutils-0.2.4-h16e98cb_5<br />Linking aws-c-cal-0.9.14-h8e43964_1<br />Linking glog-0.7.1-hbabe93e_0<br />Linking libthrift-0.22.0-h7d032f7_2<br />Linking libopenblas-0.3.33-pthreads_h94d23a6_0<br />Linking libfreetype-2.14.3-ha770c72_0<br />Linking brotli-bin-1.2.0-hb03c661_1<br />Linking lcms2-2.19.1-h0c24ade_0<br />Linking openjpeg-2.5.4-h55fea9a_0<br />Linking azure-storage-blobs-cpp-12.17.0-hf824e48_1<br />Linking re2-2025.11.05-h5301d42_1<br />Linking aws-c-io-0.26.3-h955231c_3<br />Linking libblas-3.11.0-8_h4a7cf45_openblas<br />Linking fontconfig-2.18.0-h27c8c51_0<br />Linking freetype-2.14.3-ha770c72_0<br />Linking brotli-1.2.0-hed03a55_1<br />Linking azure-storage-files-datalake-cpp-12.15.0-h1e5b466_0<br />Linking libgrpc-1.78.1-h1d1128b_0<br />Linking aws-c-event-stream-0.7.1-h9be7a74_1<br />Linking aws-c-http-0.11.0-hcbcd92d_1<br />Linking libcblas-3.11.0-8_h0358290_openblas<br />Linking liblapack-3.11.0-8_h47877c9_openblas<br />Linking libopentelemetry-cpp-1.26.0-h9692893_0<br />Linking aws-c-auth-0.10.3-h3aafcba_1<br />Linking aws-c-mqtt-0.15.2-h8af55cf_3<br />Linking libgoogle-cloud-3.5.0-h25dbb67_0<br />Linking aws-c-s3-0.12.3-h00bea6e_2<br />Linking libgoogle-cloud-storage-3.5.0-hdbdcf42_0<br />Linking aws-crt-cpp-0.38.3-h7b0d4b4_2<br />Linking aws-sdk-cpp-1.11.747-h5a171d8_5<br />Linking python_abi-3.14-8_cp314<br />Linking font-ttf-dejavu-sans-mono-2.37-hab24e00_0<br />Linking tzdata-2025c-hc9c84f9_1<br />Linking font-ttf-ubuntu-0.83-h77eed37_3<br />Linking font-ttf-inconsolata-3.000-h77eed37_0<br />Linking font-ttf-source-code-pro-2.038-h77eed37_0<br />Linking fonts-conda-forge-1-hc364b38_1<br />Linking orc-2.3.0-h21090e2_0<br />Linking python-3.14.5-habeac84_100_cp314<br />Linking kaleido-core-0.2.1-h3644ca4_0<br />Linking libarrow-24.0.0-h6f10b76_3_cpu<br />Linking libparquet-24.0.0-h7376487_3_cpu<br />Linking libarrow-compute-24.0.0-h53684a4_3_cpu<br />Linking libarrow-acero-24.0.0-h635bf11_3_cpu<br />Linking libarrow-dataset-24.0.0-h635bf11_3_cpu<br />Linking libarrow-substrait-24.0.0-hb4dd7c2_3_cpu<br />Linking pip-26.1.1-pyh145f28c_0<br />Linking tomli-2.4.1-pyhcf101f3_0<br />Linking six-1.17.0-pyhe01879c_1<br />Linking pysocks-1.7.1-pyha55dd90_7<br />Linking hyperframe-6.1.0-pyhd8ed1ab_0<br />Linking hpack-4.1.0-pyhd8ed1ab_0<br />Linking backports.zstd-1.5.0-py314h680f03e_0<br />Linking pyparsing-3.3.2-pyhcf101f3_0<br />Linking cycler-0.12.1-pyhcf101f3_2<br />Linking sniffio-1.3.1-pyhd8ed1ab_2<br />Linking mdurl-0.1.2-pyhd8ed1ab_1<br />Linking narwhals-2.21.2-pyhcf101f3_0<br />Linking packaging-26.2-pyhc364b38_0<br />Linking charset-normalizer-3.4.7-pyhd8ed1ab_0<br />Linking certifi-2026.5.20-pyhd8ed1ab_0<br />Linking idna-3.17-pyhcf101f3_0<br />Linking pygments-2.20.0-pyhd8ed1ab_0<br />Linking shellingham-1.5.4-pyhd8ed1ab_2<br />Linking annotated-doc-0.0.4-pyhcf101f3_0<br />Linking colorama-0.4.6-pyhd8ed1ab_1<br />Linking typing_extensions-4.15.0-pyhcf101f3_0<br />Linking click-8.4.1-pyhc90fa1f_0<br />Linking tqdm-4.67.3-pyh8f84b5b_0<br />Linking python-kaleido-0.2.1-pyhd8ed1ab_0<br />Linking python-multipart-0.0.29-pyhcf101f3_0<br />Linking python-dotenv-1.2.2-pyhcf101f3_0<br />Linking argcomplete-3.6.3-pyhd8ed1ab_0<br />Linking python-dateutil-2.9.0.post0-pyhe01879c_2<br />Linking h2-4.3.0-pyhcf101f3_0<br />Linking dnspython-2.8.0-pyhcf101f3_0<br />Linking markdown-it-py-4.2.0-pyhd8ed1ab_0<br />Linking plotly-6.6.0-pyhd8ed1ab_0<br />Linking exceptiongroup-1.3.1-pyhd8ed1ab_0<br />Linking typing-inspection-0.4.2-pyhcf101f3_2<br />Linking typing-extensions-4.15.0-h396c80c_0<br />Linking h11-0.16.0-pyhcf101f3_1<br />Linking email-validator-2.3.0-pyhd8ed1ab_0<br />Linking rich-15.0.0-pyhcf101f3_0<br />Linking anyio-4.13.0-pyhcf101f3_0<br />Linking annotated-types-0.7.0-pyhd8ed1ab_1<br />Linking uvicorn-0.48.0-pyhc90fa1f_0<br />Linking email_validator-2.3.0-hd8ed1ab_0<br />Linking rich-toolkit-0.19.10-pyhcf101f3_0<br />Linking typer-0.26.3-pyhcf101f3_0<br />Linking rich-click-1.9.8-pyh8f84b5b_0<br />Linking rich-argparse-1.8.0-pyhd8ed1ab_0<br />Linking httpcore-1.0.9-pyh29332c3_0<br />Linking starlette-1.1.0-pyhcf101f3_0<br />Linking httpx-0.28.1-pyhd8ed1ab_0<br />Linking pyarrow-core-24.0.0-py314h969be7f_0_cpu<br />Linking unicodedata2-17.0.1-py314h5bd0f2a_0<br />Linking brotli-python-1.2.0-py314h3de4e8d_1<br />Linking pillow-12.2.0-py314h8ec4b1a_0<br />Linking kiwisolver-1.5.0-py314h97ea11e_0<br />Linking fastar-0.11.0-py314h0b738fb_0<br />Linking markupsafe-3.0.3-py314h67df5f8_1<br />Linking websockets-16.0-py314h0f05182_1<br />Linking uvloop-0.22.1-py314h5bd0f2a_1<br />Linking pyyaml-6.0.3-py314h67df5f8_1<br />Linking httptools-0.7.1-py314h5bd0f2a_1<br />Linking numpy-2.4.6-py314h2b28147_0<br />Linking pydantic-core-2.46.4-py314h2e6c369_0<br />Linking watchfiles-1.2.0-py314ha5689aa_0<br />Linking pyarrow-24.0.0-py314hdafbbf9_0<br />Linking contourpy-1.3.3-py314h97ea11e_4<br />Linking biopython-1.87-py314h5bd0f2a_0<br />Linking pandas-3.0.3-py314hb4ffadd_0<br />Linking munkres-1.0.7-py_1<br />Linking urllib3-2.7.0-pyhd8ed1ab_0<br />Linking jinja2-3.1.6-pyhcf101f3_1<br />Linking pydantic-2.13.4-pyhcf101f3_0<br />Linking uvicorn-standard-0.48.0-he364bde_0<br />Linking fonttools-4.63.0-pyh7db6752_0<br />Linking requests-2.34.2-pyhcf101f3_0<br />Linking pydantic-settings-2.14.1-pyhcf101f3_0<br />Linking pydantic-extra-types-2.11.2-pyhcf101f3_0<br />Linking fastapi-core-0.136.3-pyhcf101f3_0<br />Linking fastapi-cli-0.0.23-pyhcf101f3_0<br />Linking fastapi-0.136.3-h5ddb490_0<br />Linking plotly-upset-hd-0.0.2-py_0<br />Linking matplotlib-base-3.10.9-py314h1194b4b_0<br />Linking upsetplot-0.9.0-pyhd8ed1ab_1<br />Linking perf_ssr-0.4.8-py_0<br />Linking crossroad-0.3.6-pyh7e60211_0</p><p>Transaction finished</p><p><strong>(jitENV) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$ crossroad -h</strong><br /> <br /> Usage: crossroad [OPTIONS] <br /> <br /> Run the main croSSRoad analysis pipeline, or manage jobs. <br /> <br />╭─ Options ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --version -v Show version, logo, citation, and links. │<br />│ --install-completion Install completion for the current shell. │<br />│ --show-completion Show completion for the current shell, to copy it or customize the installation. │<br />│ --help -h Show this message and exit. │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ Mode Selection ─────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --api -a Run the Crossroad web API server. │<br />│ --slurm -s Submit the analysis job to a Slurm cluster. │<br />│ --job-status JOB_ID Query the status of a specific job ID. │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ Input Files (provide --input-dir OR --fasta) ───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --input-dir -i PATH Directory containing: `all_genome.fa`, ``, ``. Exclusive with `--fasta`. │<br />│ --fasta -fa PATH Input FASTA file (e.g., `all_genome.fa`). Alternative to `--input-dir`. │<br />│ --categories -c PATH Genome categories TSV file. Optional if using `--fasta`. Ignored if `--input-dir` is used (looks for `genome_categories.tsv` inside). │<br />│ --gene-bed -b PATH Gene BED file for SSR-gene analysis. Optional. If `--input-dir` is used, looks for `gene.bed` inside. │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ Analysis Parameters ────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --reference-id -ref TEXT Reference genome ID for comparative analysis. Optional parameter for reference-based comparisons. │<br />│ --output-dir -o DIRECTORY Base output directory for jobs. Overrides CROSSROAD_JOB_DIR env var. │<br />│ --flanks -f Process flanking regions. │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ PERF SSR Detection Parameters ──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --mono INTEGER Mononucleotide repeat threshold. [default: 12] │<br />│ --di INTEGER Dinucleotide repeat threshold. [default: 6] │<br />│ --tri INTEGER Trinucleotide repeat threshold. [default: 4] │<br />│ --tetra INTEGER Tetranucleotide repeat threshold. [default: 3] │<br />│ --penta INTEGER Pentanucleotide repeat threshold. [default: 3] │<br />│ --hexa INTEGER Hexanucleotide repeat threshold. [default: 2] │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ Filtering Parameters ───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --min-len -l INTEGER Minimum genome length for filtering. [default: 1000] │<br />│ --max-len -L INTEGER Maximum genome length for filtering. [default: 10000000] │<br />│ --unfair -u INTEGER Maximum number of N's allowed per genome for Crossroad analysis. [default: 0] │<br />│ --repeat-threshold -rc INTEGER Repeat count Threshold for hotspot filtering (keeps records &gt; this value). [default: 1] │<br />│ --genome-threshold -g INTEGER Genome count Threshold for hotspot filtering (keeps records &gt; this value). [default: 2] │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯<br />╭─ Performance &amp; Output ───────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╮<br />│ --threads -t INTEGER Number of threads for Crossroad analysis. [default: 50] │<br />│ --plots -p Enable plot generation. │<br />│ --intrim-dir TEXT Name for the intermediate files directory (within the main job output dir). [default: intrim] │<br />╰──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────────╯</p><p>(jitENV) hp@hp-HP-Z2-Tower-G9-Workstation-Desktop-PC:~/jitendraTEST$</p><p>&nbsp;</p>]]></description>
	<dc:creator>ComBioX</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

</channel>
</rss>