<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27257?offset=530</link>
	<atom:link href="https://bioinformaticsonline.com/related/27257?offset=530" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22026/igib-recruitment-2015-%E2%80%93-project-scientist</guid>
  <pubDate>Tue, 14 Apr 2015 12:19:59 -0500</pubDate>
  <link></link>
  <title><![CDATA[IGIB Recruitment 2015 – Project Scientist]]></title>
  <description><![CDATA[
<p>IGIB Recruitment 2015 – Project Scientist &amp; SPF Posts: CSIR – Institute of Genomics &amp; Integrative Biology (IGIB) has issued notification for the recruitment of Project Scientist, Sr Project Fellow vacancies on temporary basis for project entitled “Setting up of CSIR(unit)-TRISUTRA (Translational research and Innovative Science through Ayurgenomics)”. Eligible candidates may apply in prescribed application format on or before 23-04-2015. Other details like age limit, educational qualification, selection process &amp; how to apply are given below…</p>

<p>IGIB Vacancy Details:<br />Total No. of Posts: 04<br />Name of the Posts:<br />1. Project Scientist (Biology): 02 Posts<br />2. Project Scientist (Bioinformatics): 01 Post<br />3. Sr Project Fellow (Ayurveda): 01 Post</p>

<p>Age Limit: Candidates age should be 35 years for post 1, 32 years for post 2</p>

<p>Educational Qualification: Candidates should have Ph.D/ Ph.D submitted in any branch of Biological Science/ Life Science for post 1, Ph.D/ Ph.D submitted in Bioinformatics for post 2, BAMS degree with one year internship for post 3.</p>

<p>Selection Process: Candidates will be selected based on their performance in interview.</p>

<p>How to Apply: Eligible candidates may send their application along with all relevant documents on or before 23-04-2015.</p>

<p>Important Dates:<br />Last Date for Receipt of Application for Post 1 &amp; 2: 23-04-2015.<br />Date of Interview for Post 3: 27-04-2015.</p>

<p>For other details like pay scale, age relaxation, educational qualification, selection process, how to apply, etc., click on the link given below…</p>

<p>http://www.freejobalert.com/wp-content/uploads/2015/03/Notification-IGIB-Project-Scientist-SPF-Posts.pdf</p>

<p>http://www.igib.res.in/sites/default/files/27042015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22047/binc-sample-question-paper</guid>
	<pubDate>Thu, 16 Apr 2015 09:14:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22047/binc-sample-question-paper</link>
	<title><![CDATA[BINC Sample Question Paper !!!]]></title>
	<description><![CDATA[<p>BINC sample question paper round TWO.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22047" length="1621" type="text/plain" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22072/bioinformatics-jrfrasrf-position-at-indian-institute-of-science-education-and-research-iiser-kolkata-kolkata-west-bengal</guid>
  <pubDate>Fri, 17 Apr 2015 04:11:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF/RA/SRF position at Indian Institute of Science Education and Research (IISER Kolkata) - Kolkata, West Bengal]]></title>
  <description><![CDATA[
<p>Research Position in Computational Biology in the group of Shree P. Pandey Positions available in the area of NGS data analysis, bioinformatics, plant genomics</p>

<p>Project Description: Projects involves high throughput analysis of data mostly generated by massively parallel sequencing (RNA-Seq and small-RNA-Seq), microarrays and related platforms. We are looking for highly motivated and bright individuals interested in high-throughput cutting-edge data analyses methods in genomics (computational positions). Available positions: Applications are invited from suitable candidates in both, the Max Planck India Partner Program and the CRP Wheat Program for openings at the levels:</p>

<p>Post Name-Qualification-Salary:<br />Project assistant – Master’s – Rs. 14000<br />Project fellow (junior data analyst) – Masters + research experience – Rs. 16000<br />Research fellow (senior data analyst) – Masters + adequate research experience/desirable skill sets – Rs. 22000<br />Research Associated – PhD (&lt; 1yr) /&gt; 1 yr experience – Rs. 28000 / Rs. 32000<br />Essential qualification: MSc/MTech/PhD (or other suitable qualification) in discipline related to bioinformatics, computational biology, computer application (or equivalent)/ ‘Advance Post-Graduate Diploma in Bioinformatics’. Proficiency in one of the programming languages or statistics (proficient in R for example) is compulsory.<br />Desirable qualification: 1. Programming experiences in at least one low level language such as C/C++ and one scripting language such as Perl/Python/PHP and knowledge of SQL/MySQL. 2. Substantial experience in the linux or other unix environments. 3. Experience of working in projects on Bioinformatics, Genetics or Biological application areas/Computational and Statistical analysis (e.g. using R or Matlab). Experience in the field of genomics (NGS, microarrays, genome annotation), database development and management, software development, systems and network biology (or related fields) will be preferred.<br />SELECTION PROCEDURE FOR INDIAN INSTITUTE OF SCIENCE EDUCATION AND RESEARCH (IISER KOLKATA) – RESEARCH ASSOCIATE &amp; MORE VACANCIES POST:</p>

<p>Candidates can apply on or before 30/04/2015<br />No Detailed information about the selection process is mentioned in the recruitment notification<br />HOW TO APPLY FOR RESEARCH ASSOCIATE &amp; MORE VACANCIES IN INDIAN INSTITUTE OF SCIENCE EDUCATION AND RESEARCH (IISER KOLKATA):</p>

<p>Applications should contain CV along with brief description (maximum 1 page) of research conducted (highlighting skills and experience) till now. Applications should be sent by email to Shree P. Pandey, Department of Biological Sciences, IISER-Kolkata, Mohanpur Campus, West Bengal within 2 weeks. Interviews will be scheduled within 10 days of closing of applications. E-mail: sppiiserkol@gmail.com, sppandey@iiserkol.ac.in<br />For more details visit: http://www.iiserkol.ac.in/~sppandey</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22235/project-fellow-bioinformatics-at-central-drug-research-institute</guid>
  <pubDate>Mon, 27 Apr 2015 20:15:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Project Fellow Bioinformatics at Central Drug Research Institute]]></title>
  <description><![CDATA[
<p>Project Fellow (Bioinformatics)<br />Central Drug Research Institute<br />Address: Chattar Manzil, M.G.Road, Kaisarbagh<br />Postal Code: 226001<br />City: Lucknow<br />State: Uttar Pradesh<br />Pay Scale: Rs.16,000/- (fixed) p.m.<br />Educational Requirements: M.Sc. in Bioinformatics with 55% marks for Gen. &amp; OBC and 50% marks for SC/ST candidates, Physically and Visually handicapped candidates<br />Experience Requirements: Experience in computer-assisted scientific research in the area of Drug Design including Bio- molecular modeling and simulation studies, Virtual screening, pharmacophore perception, QSAR etc. Familiarity with Linux/Unixbased computer systems and required to participate and contribute to the development and application of computational models for the design and discovery of novel molecules as inhibitors or chemical probes<br />Details will be available at: http://cdriindia.org/uploaded/advt_no01-2015.pdf</p>

<p>How To Apply: Eligible candidates required to report for the Interview at 9:00 A.M. sharp on 11-05-2015 (For Position Code No. 001 to 009) and 12-05-2015 (For Position Code No. 010 to 016). Candidates reporting after 10:00 A.M will not be allowed to attend the interview. Eligible candidates may appear before the Selection Committee for interview on the date and time mentioned above at CDRI, B.S. 10/1, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow-226031. Eligible candidates must bring with them duly filled up application form (which can be downloaded from our website www.cdriindia.org), along with Original certificates as well as attested copies of certificates of examinations starting from matriculation, date of birth, caste certificate (in case of SC/ST/OBC) experience certificate, publication, if any and recent passport size photograph etc. Original documents are essential for verification of the particulars quoted by the candidate in the application form and candidate failed to produce original documents at the time of verification, shall not be allowed to attend the interview. Any request for relaxation in this regard shall not be entertained.<br />Detail of Interview: 11-05-2015<br />Age Limit: 28 Years</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22269/school-of-life-sciences-jawaharlal-nehru-university-vacancy-of-jrf-srf-ra-in-csir-funded-project</guid>
  <pubDate>Wed, 29 Apr 2015 21:26:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Project]]></title>
  <description><![CDATA[
<p>School of Life Sciences, Jawaharlal Nehru University has issued notification dated 27.04.2015 to fill the vacancy of JRF / SRF / RA in CSIR funded Projec entitled "Structural and functional characterization of serine biosynthetic pathway enzymes from entamoeba histolytica". It is good chance to get job with IITKGP and brighten your future. Learn eligibility criteria and apply on or before 08.05.2015.</p>

<p>Employer:	Jawaharlal Nehru University<br />Address:	Dr. S. Gourinath, Principal Investigator, School Of Life Sciences, Jawaharlal Nehru University, New Delhi-110067<br />Email:	not mentioned / provided for this job post<br />URL:	http://www.jnu.ac.in/Career/currentjobs.htm<br />Phone:	011 2674 2575<br />Skills:	not mentioned / required for this job post<br />Experience:	Experience in molecular biology, structural biology and bioinformatics is desired<br />Education:	M.Sc. in any field of life sciences.<br />Job Location:	New Delhi, Delhi, India   (View Jobs in New Delhi,   Jobs in Delhi,   Jobs in India)</p>

<p>Job Description: School of Life Sciences, Jawaharlal Nehru University vacancy of JRF / SRF / RA in CSIR funded Projec</p>

<p>Name of the Post: JRF / SRF / RA</p>

<p>Salary: As per rules</p>

<p>Required Job Profile:</p>

<p>Candidate must possess M.Sc. in any field of life sciences.</p>

<p>Desired Job Profile:</p>

<p>Candidate having NET - CSIR or UGC and experience in molecular biology, structural biology and bioinformatics is desired and experience with publication is preferred.</p>

<p>How to apply:</p>

<p>Eligible and interested candidates should need to apply with complete details to the above mentioned address on or before 08.05.2015.</p>

<p>Refer to http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22287/research-fellows-at-aimscs-hyderabad</guid>
  <pubDate>Wed, 06 May 2015 06:23:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellows at AIMSCS, Hyderabad]]></title>
  <description><![CDATA[
<p>C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh<br />Advertisement No.: 5/2015</p>

<p>Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)</p>

<p>JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,</p>

<p>Pay Scale : Rs. 25,000</p>

<p>SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.</p>

<p>Pay Scale : Rs. 28,000*</p>

<p>No.of Post: 2</p>

<p>Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.</p>

<p>More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>