Research Associate (one post): Emoluments as per DST/DBT norms & as sanctioned in the project

Qualification: Candidates having Ph.D. degree (awarded) in any discipline of Life Sciences with good publication record are eligible to apply. Candidates having prior experience in the area of Genetic and molecular analysis of plant/fungus for disease resistance/susceptibility of transcriptome and genome analysis will be preferred.

Junior Research Fellow (one post): Emoluments as per DST/DBT norms & as sanctioned in the project

Qualification: Candidates having M.Sc./M.Tech degree in any discipline of Life Sciences/Engineering (with minimum 55% marks) are eligible to apply. The Candidate having prior work experience in Molecular biology of plants/animal/fungus or Computational biology with experience in analysis of next-generation sequencing data, protein-protein interaction and system biology will be given preference.

The positions are purely temporary and are co-terminus with the project. The initial appointment will be for one year, which can be extended/curtailed on the basis of assessment of the candidate’s performance and discretion of the Competent Authority. The eligible candidates may further be shortlisted based on the qualification/experience depending on the total number of applications received. NIPGR reserves the right to select the candidate against the above post depending upon the qualification(s) and experience of the candidate. Reservation of post shall be as per Govt. of India norms.

Eligible candidates may apply by sending their complete application in the enclosed format.

The attested copies of the certificates and proof of research experience (if any) are to be attached with the hard copy of application. The applications should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by “Application for the Post of RA/JRF in the CPCFG Project” of Dr. Praveen Verma.

http://www.nipgr.res.in/files/careers/app_format_RA_JRF.docx

Contact Person address
Dr. Praveen Verma
Staff Scientist-VI & Principal Investigator ,
National Institute of Plant Genome Research ,(NIPGR)
Aruna Asaf Ali Marg, P.O. Box NO. 10531,
New Delhi - 110067

1. Make friends with local bioinformatics groups
2. Talk to your computing group
3. Obtain clear expectations
4. Rewrite your job description
5. Papers
6. Attend bioinformatics meetings
7. Try first, ask later

Address of the bookmark: http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

The Job detail

Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity
Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions
Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data
Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS
Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles
Providing support to MSc and PhD students on topic related to its major core of research
Any other work assigned by the supervisor

The Person:

PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;
familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;
ability to create new analytical pipelines; experience with handling large data sets;
ability to program in at least two of the following: C++, PERL, Python, R, Java.
will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.

Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.

How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.

More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm

Webpage : https://www.scilifelab.se/about-us/
Opportunity: https://www.scilifelab.se/about-us/career/

mod_rewrite provides a flexible and powerful way to manipulate URLs using an unlimited number of rules. Each rule can have an unlimited number of attached rule conditions, to allow you to rewrite URL based on server variables, environment variables, HTTP headers, or time stamps.

mod_rewrite operates on the full URL path, including the path-info section. A rewrite rule can be invoked in httpd.conf or in .htaccess. The path generated by a rewrite rule can include a query string, or can lead to internal sub-processing, external request redirection, or internal proxy throughput.

Further details, discussion, and examples, are provided in the detailed mod_rewrite documentation.

• sudo a2enmod rewrite

• sudo systemctl restart apache2

• sudo nano /etc/apache2/sites-available/000-default.conf

Write this

<VirtualHost *:80>
    <Directory /var/www/html>
        Options Indexes FollowSymLinks MultiViews
        AllowOverride All
        Require all granted
    </Directory>

    . . .
</VirtualHost>

Address of the bookmark: https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04

Walk- in- Test cum Interview (based on test) for the selection of Research Associate

under the scheme “Distributed Information Sub Centre –DISC” & Research Assistant under scheme “Phytophthora, Fusarium and Ralstonia diseases of Horticultural and Field Crops” will be held at this Institute as per details indicated below.

WALK -IN- TEST CUM INTERVIEW

Name of the post : Research Associate

Date of Interview : 21-05-2014 at 10.00 AM

No. of posts : One

Qualifications : a)Essential

Ph.D Degree in Bioinformatics OR : Masters degree in Bioinformatics with a minimum of
60% marks or equivalent OGPA with at least two years research experience as evidenced from fellowship/ associateship/training/published papers etc.

b)Desirable: Experience in NGS data analysis.

Emoluments : Rs. 23,000/- per month + HRA (Masters Degree Holders)

Rs. 24,000/- per month + HRA (Ph.D Degree Holders)

Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)

Duration of Project : Till 31-03-2017.

Title of Assigment : Research Assistant (on contract basis)

No. of vacancy : One

Qualification : Essential : Post Graduation in Bioinformatics and Minimum one year experience in NGS data analysis

Desirable : Experience in Perl/Python/R

Remuneration : Rs. 20,000/- per month (consolidated)

Scope of work :

1. Analysis of different file formats and their conversions.

2. Assessing the quality of data and filtering of raw reads.
3. Assembling the raw reads-de novo as well as reference mapping.
4. Compression of aligned reads using Jam tools
5. RNA-seq. Analysis
6. Differential expression testing involving Normalization, Statistical testing, heat map generation & hierarchical clustering
7. Annotating the assembled genome and geneet testing and their validation
8. Metabolic pathway analysis
9. Comparative genomics
10. Setting up of genome browsers.

Period of Assigment : Initially for six months.

Date & Venue of Interview : 21-05-2014 at IISR, Kozhikode at 10.00 AM

More at http://www.spices.res.in/pdf/disc-advtmnt.pdf

1. MISA: MISA (MIcroSAtellite) is a web-based tool that can identify SSRs in DNA sequences. It can be used to analyze nucleotide sequences from various organisms and can identify perfect, compound, and imperfect SSRs.

2. SSR Locator: SSR Locator is a web-based tool that identifies SSRs in both DNA and RNA sequences. It can identify perfect, compound, and imperfect SSRs, and can also filter out low complexity regions.

3. SciRoKo: SciRoKo is a software tool that can identify SSRs in DNA sequences. It can be used to analyze genomic and transcriptomic sequences from various organisms and can identify perfect, compound, and imperfect SSRs.

4. Primer3: Primer3 is a web-based tool that designs PCR primers for SSRs. It can design primers for perfect and imperfect SSRs, and can be used to design primers for SSRs in various organisms.

5. QDD: QDD (Quick Detection of Duplication) is a software tool that can identify SSRs in DNA sequences and can also identify duplicate loci. It can be used to analyze genomic and transcriptomic sequences from various organisms.

These are just a few examples of the many bioinformatics tools available for exploring SSRs. Depending on your specific needs and research questions, you may find that other tools are more appropriate for your analysis.

Address of the bookmark: http://www.programmingr.com/category/stype/r-job-listings/