1. SPAdes: An assembler specifically designed for single-cell and multi-cell bacterial genomes, as well as small eukaryotic genomes.

2. ABySS: A parallelized assembler for large genomes that uses de Bruijn graphs.

3. Velvet: Another de Bruijn graph-based assembler optimized for short-read sequencing data.

4. SOAPdenovo: A de Bruijn graph-based assembler designed for short reads, widely used for assembling large and complex genomes.

5. MaSuRCA: A hybrid assembler that combines data from multiple sequencing technologies, such as Illumina and PacBio.

6. Canu: A long-read assembler optimized for PacBio and Oxford Nanopore sequencing data.

7. Flye: A long-read assembler suitable for bacterial and small eukaryotic genomes.

8. SMARTdenovo: An assembler designed for long reads, particularly suited for PacBio data.

9. SPAdes Long Read (SPAdesLR): An extension of SPAdes for long-read data, such as those from PacBio or Nanopore.

10. Minia: An assembler optimized for low memory consumption, suitable for small and medium-sized genomes.

11. Unicycler: A hybrid assembler that combines short and long reads for circular bacterial genome assembly.

12. wtdbg2: A de Bruijn graph assembler for long reads, efficient for very large genomes.

13. Shasta: A long-read assembler that uses the Overlap-Layout-Consensus approach, suitable for PacBio and Nanopore data.

14. Sparc: An assembler designed to handle noisy long reads from Nanopore sequencing.

15. CANA: An assembler for metagenomic data, particularly for complex and diverse microbial communities.

16. Ra Assembler: A metagenome assembler for long reads, designed for highly complex metagenomic samples.

Please note that the field of bioinformatics is constantly evolving, and new assembly tools may have emerged since my last update. Additionally, the performance of these tools can vary depending on the characteristics of the sequencing data and the genome being assembled. When selecting an assembly tool, consider the specific requirements of your project, the available data types, and the computational resources at your disposal. Always refer to the respective tool's documentation and publications for the most up-to-date information and recommendations.

Bose Institute, Kolkata, invites applications from Indian Citizens for ONE (01) temporary position of Junior Research Fellow in the DBT sponsored project entitled, “Centre of Excellance (CoE) in Bioinformatics at Bose Institute”, running under Prof. Pinakpani Chakrabarti, Project Co-ordinatior, Bioinformatics Centre. The project is tenable upto 31.03.2017, but duration of the fellowship is one year only. The JRF will work with one of the faculty members of the center based on his / her motivation in any specific area on Bioinformatics.

Essential Qualification: 1st class M.Sc. / M.Tech degree in any stream of Chemical/ Biological Sciences with CSIR-UGC-NET-JRF / ICMR-JRF / DBT-JRF or CSIR-UGCNET- LS / GATE qualification.

Desirable qualification:

(i) Specialized knowledge in Organic / Physical chemistry.
(ii) Any exposure to research involving the small molecules (like drug) and / or protein structure determination or prediction.
(iii) Basic knowledge in computer programming, e.g. using FORTRAN, C, shell, perl etc.
(iv) Hands-on-experience on any of the following software : CHARMM/AMBER/NAMD/GROMACS,Gaussian/Gamess, Haddock/Autodock, Schrodinger etc. (or any other software serving similar purposes in molecular modeling)

Fellowship :

(i) Rs. 16,000/- p.m., plus admissible HRA & Medical Benefit for M.Sc. with CSIRUGC NET-JRF/ICMR-JRF/DBT-JRF or M.Tech. with CSIR-UGC NETJRF/
ICMR-JRF/DBT-JRF/CSIR-UGC NET-LS/GATE
(ii) Rs. 12,000/- p.m., plus admissible HRA & Medical Benefit for M.Sc. with CSIRUGC NET-LS/GATE

Age : Below 28 years as on the day on which the application is made (relaxable in case of SC/ST/OBC/WOMEN candidates only as per rule).

Interested and eligible candidates should apply on plain paper duly signed by them clearly mentioning the area of interest in research, possession of any desirable qualification (s) as mentioned above and quoting Advertisement No. on the envelop as well as application with complete Bio-data giving e-mail ID, Phone No. and details of qualification i.e. examination passed, year, division, percentage of marks, from Secondary onwards with attested copies of testimonials, addressed to the Registrar, Bose Institute, P-1/12, CIT Scheme VII-M, Kankurgachi, Kolkata-700054 on or before April 25, 2014.

The shortlisted candidates will be called for an interview. Applicants are advised to check our website for future updates.

Advertisement: www.boseinst.ernet.in/ADVT/14/p_2.pdf

Address of the bookmark: https://biokit.readthedocs.io/en/latest/index.html

The fate of a cell is ultimately the product of the regulation of its genes. Gene regulation is a coordinated process acting at multiple levels of which transcription and translation are the most prominent. The Valen group is dedicated to the fundamental question of how transcription and translation is integrated to obtain the desired protein abundance. The recent development of high-throughput next generation sequencing techniques to monitor both active translation and transcription has made it possible to study this connection at the genome scale.

This project aims to elucidate the links between regulation of translation and transcription. The applicant will analyze next generation sequencing data and model gene regulation on a genome-wide level to identify the features that affect the translational output of transcripts. The work will be done in close collaboration with experimental scientists who will test the predictions of the computational models.

Additional information on the position can be obtained by contacting Eivind Valen (eivind.valen@ii.uib.no).

The research fellow must take part in the University’s approved PhD program leading to the degree within a time limit of 3 years. Application for admission to the PhD program, including a project plan outline for the training module, will be worked out in collaboration with the research group in question.

In total, the fellowship period is 4 years, 25 % of this will be allocated to teaching and/or administrative duties. The fellowship period may be reduced if the successful applicant has held previous employment as a research fellow or similar.

http://www.jobbnorge.no/en/available-jobs/job/102235/research-fellow-phd-candidate-in-computational-biology-2-positions

Research Associate (one post): Emoluments as per DST/DBT norms & as sanctioned in the project

Qualification: Candidates having Ph.D. degree (awarded) in any discipline of Life Sciences with good publication record are eligible to apply. Candidates having prior experience in the area of Genetic and molecular analysis of plant/fungus for disease resistance/susceptibility of transcriptome and genome analysis will be preferred.

Junior Research Fellow (one post): Emoluments as per DST/DBT norms & as sanctioned in the project

Qualification: Candidates having M.Sc./M.Tech degree in any discipline of Life Sciences/Engineering (with minimum 55% marks) are eligible to apply. The Candidate having prior work experience in Molecular biology of plants/animal/fungus or Computational biology with experience in analysis of next-generation sequencing data, protein-protein interaction and system biology will be given preference.

The positions are purely temporary and are co-terminus with the project. The initial appointment will be for one year, which can be extended/curtailed on the basis of assessment of the candidate’s performance and discretion of the Competent Authority. The eligible candidates may further be shortlisted based on the qualification/experience depending on the total number of applications received. NIPGR reserves the right to select the candidate against the above post depending upon the qualification(s) and experience of the candidate. Reservation of post shall be as per Govt. of India norms.

Eligible candidates may apply by sending their complete application in the enclosed format.

The attested copies of the certificates and proof of research experience (if any) are to be attached with the hard copy of application. The applications should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by “Application for the Post of RA/JRF in the CPCFG Project” of Dr. Praveen Verma.

http://www.nipgr.res.in/files/careers/app_format_RA_JRF.docx

Contact Person address
Dr. Praveen Verma
Staff Scientist-VI & Principal Investigator ,
National Institute of Plant Genome Research ,(NIPGR)
Aruna Asaf Ali Marg, P.O. Box NO. 10531,
New Delhi - 110067

1. Make friends with local bioinformatics groups
2. Talk to your computing group
3. Obtain clear expectations
4. Rewrite your job description
5. Papers
6. Attend bioinformatics meetings
7. Try first, ask later

Address of the bookmark: http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

The Job detail

Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity
Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions
Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data
Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS
Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles
Providing support to MSc and PhD students on topic related to its major core of research
Any other work assigned by the supervisor

The Person:

PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;
familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;
ability to create new analytical pipelines; experience with handling large data sets;
ability to program in at least two of the following: C++, PERL, Python, R, Java.
will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.

Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.

How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.

More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm

Webpage : https://www.scilifelab.se/about-us/
Opportunity: https://www.scilifelab.se/about-us/career/