Address of the bookmark: http://wego.genomics.org.cn/

mixtureS that can de novo identify bacterial strains from shotgun reads of a clonal or metagenomic sample, without prior knowledge about the strains and their variations. Tested on 243 simulated datasets and 195 experimental datasets, mixtureS reliably identified the strains, their numbers and their abundance. Compared with three tools, mixtureS showed better performance in almost all simulated datasets and the vast majority of experimental datasets.

Address of the bookmark: http://www.cs.ucf.edu/~xiaoman/mixtureS/

1) A cell line expressing or lacking single TF,

2) Breast tumors divided along PAM50 designations

3) Whole brain samples from WT mice or mice lacking a single TF in a particular neuronal subtype

4) Single cell RNAseq analysis of neurons divided by Immediate Early Gene expression levels.

In summary, MAGIC is a standalone application that produces meaningful predictions of TFs and cofactors in transcriptomic experiments.

More at https://uwmadison.app.box.com/s/8j90e5h2rjrsz3bacaxnq8kor2o64vyg

Address of the bookmark: https://github.com/asroopra/MAGIC

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-020-6568-2

Address of the bookmark: https://github.com/HuffordLab/GenomeQC

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Features

• Circular and linear views of genomes

• Capable of drawing genomes up to 10 Mbp with 1000's of features and 100's contigs

• Smooth zooming down to the sequence level

• Easily generate features and plots directly form the sequence (e.g. ORFs, GC-content and GC-Skew)

• Save high resolution PNG maps up to 8000x8000px

• Fully documented API for interacting with CGView.js maps

Address of the bookmark: https://js.cgview.ca/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

LoVis4u is a bioinformatics tool for Loci Visualisation.

LoVis4u, a command-line tool and Python API designed for highly customizable and fast visualisation of multiple genomic loci. LoVis4u generates vector images in PDF format based on annotation data from GenBank or GFF files. It is capable of visualising entire genomes of bacteriophages as well as plasmids and user-defined regions of longer prokaryotic genomes. Additionally, LoVis4u offers optional data processing steps to identify and highlight accessory and core genes in input sequences.

https://art-egorov.github.io/lovis4u/

Address of the bookmark: https://github.com/art-egorov/lovis4u