BOL: Related items

LoRMA: A tool for correcting sequencing errors in long reads

Abhimanyu Singh — Thu, 06 Sep 2018 16:21:01 -0500

An error correction method that uses long reads only. The method consists of two phases: first, we use an iterative alignment-free correction method based on de Bruijn graphs with increasing length of k-mers, and second, the corrected reads are further polished using long-distance dependencies that are found using multiple alignments. According to our experiments, the proposed method is the most accurate one relying on long reads only for read sets with high coverage. Furthermore, when the coverage of the read set is at least 75×, the throughput of the new method is at least 20% higher.

conda install -c atgc-montpellier lorma

Address of the bookmark: https://gite.lirmm.fr/lorma/lorma-releases/wikis/home

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

ClipCrop: a tool for detecting structural variations with single-base resolution using soft-clipping information

Rahul Nayak — Thu, 04 Oct 2018 16:39:28 -0500

This is a tool for detecting structural variations using soft-clipping information From SAM files.

https://github.com/shinout/clipcrop

Address of the bookmark: https://github.com/shinout/clipcrop

Hawkeye: an interactive visual analytics tool for genome assemblies

Abhimanyu Singh — Tue, 01 Jan 2019 11:56:17 -0600

Genome sequencing remains an inexact science, and genome sequences can contain significant errors if they are not carefully examined. Hawkeye is our new visual analytics tool for genome assemblies, designed to aid in identifying and correcting assembly errors. Users can analyze all levels of an assembly along with summary statistics and assembly metrics, and are guided by a ranking component towards likely mis-assemblies. Hawkeye is freely available and released as part of the open source AMOS project http://amos.sourceforge.net/hawkeye.

https://genomebiology.biomedcentral.com/articles/10.1186/gb-2007-8-3-r34

Address of the bookmark: http://amos.sourceforge.net/wiki/index.php?title=Hawkeye

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Minipolish: A tool for Racon polishing of miniasm assemblies

BioStar — Tue, 03 Dec 2019 02:40:54 -0600

Miniasm is a great long-read assembly tool: straight-forward, effective and very fast. However, it does not include a polishing step, so its assemblies have a high error rate – they are essentially made of stitched-together pieces of long reads.

Racon is a great polishing tool that can be used to clean up assembly errors. It's also very fast and well suited for long-read data. However, it operates on FASTA files, not the GFA graphs that miniasm makes.

That's where Minipolish comes in. With a single command, it will use Racon to polish up a miniasm assembly, while keeping the assembly in graph form.

It also takes care of some of the other nuances of polishing a miniasm assembly:

Adding read depth information to contigs
Fixing sequence truncation that can occur in Racon
Adding circularising links to circular contigs if not already present (so they display better in Bandage)
'Rotating' circular contigs between polishing rounds to ensure clean circularisation

Address of the bookmark: https://github.com/rrwick/Minipolish

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

HASLR: a tool for rapid genome assembly of long sequencing reads

LEGE — Fri, 31 Jan 2020 05:50:15 -0600

HASLR is a tool for rapid genome assembly of long sequencing reads. HASLR is a hybrid tool which means it requires long reads generated by Third Generation Sequencing technologies (such as PacBio or Oxford Nanopore) together with Next Generation Sequencing reads (such as Illumina) from the same sample.

Address of the bookmark: https://github.com/vpc-ccg/haslr

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

GSP4PDB: a web tool to visualize, search and explore protein-ligand structural patterns

Neel — Sun, 15 Mar 2020 03:41:12 -0500

GSP4PDB is a user-friendly and efficient application to search and discover new patterns of protein-ligand interaction.

GSP4PDB is part of the services provided by the Bioinformatic Group of the University of Talca

http://gdblab.com/gsp4pdb/gsp4pdb2/

https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3352-x

Address of the bookmark: http://gdblab.com/gsp4pdb/gsp4pdb2/