Last Date for Submitting Application: 25th November 2013

1. Senior Scientist: (01 position)
Pay Scale: Rs.40, 000/-
Qualifications: PhD/ Post Doctoral with Experience in CADD

2. Junior Scientist (10 positions)
Pay Scale: Rs. 22,000/-
Qualifications: MPhil / Masters Degree in Bioinformatics / Computational Biology / CADD / Ayurveda

3. Technical Assistant (01+01 positions)
Pay Scale: Rs.12,000/-
Qualifications: 1. BSc Computer Science/ MCA
Qualifications: 2. MSc Biotechnology / MSc Microbiology

4. Programmer (01 position)
Pay Scale: Rs.20,000/-
Qualifications: MSc Computer Science/ MCA / B Tech (Experience in MATLAB, C, C++) Industrial experience is desirable

5. Teaching Assistant (03 positions)
Pay Scale: Rs.10,000/-
Qualifications: MSc in Bioinformatics

6. Administration Assistant (02 positions)
Pay Scale: Rs.8,000/-
Qualifications: Degree + PGDCA

The Selection process comprises of written test and interview. Positions are purely temporary (initially for the period of one year) and co-terminus with the project. For more details mail to: cbi.uok [at] gmail.com

More detail @ https://sites.google.com/site/centreforbioinformatics/announcements/applicationsinvitedforapplicationforai-caddproject

All applications sent before 2nd of February 2015.

http://www.mind-project.eu/career

WALK-IN-INTERVIEW

The following vacancies shall be filled purely on adhoc basis under Non-Institutional adhoc project “Bioinformatics in ICMR Institutes” funded by Indian Council of Medical Research at Vector Control Research Centre, Puducherry, to be renewed annually and filled through Walk-in-Interview as indicated below. Candidates who wish to appear for the Walk-in-Interview can download the application format given in the website of Vector Control Research Centre (www.vcrc.res.in). Duly filled in application along with attested copies of certificate should be submitted at time of interview.

Date & Time : 05.12.2013 at 9.00 AM – Scientist-C (Non-Medical)

05.12.2013 at 1.30 PM – Scientist-B (Non-Medical)
06.12.2013 at 9.00 AM – Technical Assistant (Research Assistant)
06.12.2013 at 1.30 PM – Multi Tasking Staff (General)

Place : Vector Control Research Centre, Puducherry

Project entitled : Biomedical Informatics Centres of ICMR

1. Scientist - C (Non-Medical) Number of post – ONE

Essential qualification

B.E./ B. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University with 6 years experience in the relevant field OR

First class Master’s Degree and Ph.D. Degree in Bioinformatics/ Computational Biology from a recognized University OR

First class Master’s Degree in Bioinformatics/ Computational Biology from a recognized University with 4 years R & D experience in the related subjects as mentioned above OR

Second class Master’s Degree + Ph.D. in Bioinformatics/ Computational Biology from a recognized University with 4 years research experience in bio-medical subjects

Age: Not exceeding 40 years Consolidated Salary – Rs.39,960/- p.m. + HRA as
admissible

Desirable qualification (i) Post-doctorate in Bioinformatics/ Computational Biology or M.E. / M. Tech. Degree in Bioinformatics/ Computational Biology from a recognized University for candidates with First Class relevant degree.

(ii) Additional post-doctoral research / teaching experience in Bioinformatics/Computational Biology in recognized Institute(s).

(iii) Knowledge of computer applications or data management

Job requirements i) To apply Bioinformatics / Computational Biology tools in understanding interactions between vectors and parasites/ pathogens and target based development of drug / insecticides.

ii) To assist the investigators to carry out genomic studies on parasites/pathogens/vectors of vector borne diseases

Advertisement: http://vcrc.res.in/Adv_Bio13.pdf

The closing date for application will be 26 June 2015.

The Law group provides internal Institute-specific development, training and support roles for data manipulation, sequence analysis and any other aspect of the analysis of biological data using computer systems. Additionally we provide databases and applications supporting the international animal science community, particularly tools and resources for genome mapping.

Head: Andy Law. Members: John Bowman (animal facility database applications), Zen Lu (bioinformatics support), Trevor Paterson (software development)

More @ http://www.bioinformatics.ed.ac.uk/groups/roslin-bioinformatics-group

• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

Novel diagnostic platform for detection of Osteoarthritis

I invite applications from highly motivated individuals to join my laboratory as a PhD student in Systems Biology at the University of Calgary McCaig Institute for Bone and Joint Health. This project is aimed at characterizing the networks of physical (protein-protein) interactions underlying inflammatory processes in patients with Osteoarthritis and how this differs from patients with Rheumatoid Arthritis and normal individuals. This work will eventually lead to the development of a novel diagnostic platform for the non-invasive and accurate detection of early Osteoarthritis. The selected candidate will use state-of-the-art computational methodologies to systematically analyze proteomic data, and develop /implement new algorithms to identify protein and functional interaction networks from high throughput experimental data. The individual will also benefit by working closely with experts at the UofC and UofA through an AIHS Alberta Osteoarthritis Team Grant which includes experts from all pillars of health research. The candidate will also be supported to attend bioinformatics workshops and conferences to advance and disseminate their research.
Qualifications: The ideal candidate will have a Master’s degree in Computational Biology, Bioinformatics, or equivalent with strong background knowledge of the Biological Sciences, Biochemistry, and Microbiology. The individual should additionally have experience in handling high-throughput data sets as well as programming skills. The candidate will be registered as a PhD student in Dr. Krawetz’s laboratory, located in the new state-of-the-art Health Research Innovation Centre at the UofC. The individual will have strong verbal and written skills and the ability to work efficiently in a team environment.

In addition to the outstanding research opportunities available in this setting, students also enjoy the many cultural and sporting amenities provided in the city of Calgary, and can take advantage of the unparalleled skiing and hiking in the Rocky Mountains that are less than an hour away.

Candidates must be academically competitive and will be expected to apply for external funding. The stipend is $25,000/yr. For outstanding PhD students, internal top-up award opportunities are available on a competitive basis. If interested in joining the lab, please contact Dr. Krawetz directly at rkrawetz@ucalgary.ca and provide the following information:

- Short cover letter explaining your interest in the lab
- Resume
- Scanned copy of transcript or listing of course grades
- Names and contact information for two individuals who will be willing to provide letters of reference

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

- Development of computational methods to investigate the interplay between epigenetic and genetic layers and their role in tumor progression, by integrating genomic, epigenomic and transcriptional data. PI: Mattia Pelizzola (http://tiny.cc/comEpi)
- Epigenome and transcriptome analysis in mouse models of Hepatocellular Carcinoma. PI: Bruno Amati - Small and long non-coding RNAs in cancer stem cells. PI: Francesco Nicassio

All projects will benefit from the availability of both in-house and publicly available next-generation sequencing datasets. Familiarity with Linux environment, programming skills (especially in R) and a background in either computational biology, or physics/engineering/math will be advantageous.

Deadline for the application January 6th, to apply: http://genomics.iit.it/resources.html

Start date: March 1st, 2014

Duration: 1+2 years

Contact Person (Referent): Mattia Pelizzola

Ref. E-Mail: mattia.pelizzola@iit.it

Tel: 0039-02-94375058
Group Web Page: http://genomics.iit.it

Bii.a-star.edu.sg

Bio research and development. Has course information and research information.

Isb-sib.ch

SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.

Bioinformatics.ca

Provides information about bioinformatics in Canada. Workshops, certification and resources.

Chickscope.beckman.uiuc.edu

Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.

Bcb.iastate.edu

Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).

Bu.edu/bioinformatics/

Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.

Bioinformatics.ubc.ca

A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.

Openhelix.com

Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.

Igb.uci.edu

Specializing in making publicly available software and database services for computational biology.

Bioinformatics.pe.kr

Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.

Groups.yahoo.com/group/bimatics/

Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.

Ncbi.nlm.nih.gov/books/NBK22183/

Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.

Bioinfo.mbb.yale.edu/mbb452a/2003/

Bioinformatics course at Yale University. All course slides are available online.

Cs.iastate.edu/~honavar/comp-bio-courses.html

Listing of computational molecular biology course pages that have extensive online course materials.

Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html

A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.

Northeastern.edu/bioinformatics/

From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.

Biocomp.unibo.it/lsbioinfo/

A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.

Cs.helsinki.fi/bioinformatiikka/mbi/programme.html

A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.

Ornl.gov/sci/techresources/Human_Genome/education/education.shtml

A resource for introductory information on the Human Genome Project.

His.se/bioinformatics

A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.

Members.tripod.com/C.elegans/

Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.

Bioinformatics.org/faq/#contents

Summary of basics of bioinformatics for the intelligent newcomer.

Jiscmail.ac.uk/archives/bioinformatics.html

Forum featuring various aspects, events and developments in the bioinformatics field.

Biinoida.blogspot.com

Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.

Colorbasepair.com/bioinformatics_courses_tutorials.html

A list of on-line course materials and tutorials for bioinformatics and computational biology.

Geospiza.com/education/

Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.

Bioinformatics.fi

An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.

Perlsource.net

Provides online courses in Perl programming for bioinformatic tools.