1. Project Junior Research Fellow / Project Assistant

Last Date: 11th Nov 2013

Qualification B.Tech (Comp. Sci.), B.Tech/M.Tech (Bioinformatics), MCA, M.Sc. (Mathematics/Statistics)

Desirable Qualifications: Programming in FORTRAN/ C /PERL, Web application technologies

Upper Age limit 28

Rs.12000 / Rs.16000 (as sanctioned by the funding agency)

General terms and conditions:

Positions are purely temporary and co-terminus with the project.

HRDG (CSIR) prevailing guidelines are applicable these positions.

All categories of applicants are required to submit online application.

Enhancement of stipend to Project JRF to Project SRF will be with the due recommendation of Principal Investigator and approval of the Director on the evaluation of the 3 member Standing Committee consisting of Chairperson at the level of Chief Scientist, Coordinator of the JRFs/RAs/PDFs and the Principal Investigator of the Project.

The age relaxation as per HRDG (CSIR) norms: SC/ST/OBC/Women/Physically Handicapped persons – five years.

The Stipend normally be fixed at Rs.22000/- for Research Associates/Post Doc. Fellows. However, a selected RA/PDF may be placed in the higher start of stipend if there is ample justification and such recommendation is made by the Selection Committee. Based on the recommendation with justification by the PI and approval of the Director, person getting stipend at lower rate may be elevated to higher rate subject to availability of the funds in the project.

Recruitment will be based on initial screening based on qualifications and experience criteria and also based on suitability of the candidates to the nature of research project. This screening will be followed by written test followed / interview. After completing this process, candidates will be shortlisted and appointed in specific project subjects as and when appropriate positions become available. The pool of selected candidates will be valid for six months.

Remunerations indicate are maximum admissible and will depend upon the availability of funds and subject to conditions applicable to projects from different funding agencies at the time of recruitment.

Apply : http://www.ccmb.res.in/positions/projects/temp_positions.php

Form download : http://www.ccmb.res.in/positions/projects/oct-2013/pdf_download.php

Address of the bookmark: http://grouthbio.com/Genome_Software_Service.php

Lab page: http://www.oeb.harvard.edu/faculty/edwards/index.html

Lab page @ http://graveleylab.cam.uchc.edu/Graveley/index.html

The closing date for application will be 26 June 2015.

Location : The Luxembourg Centre for Systems Biomedicine (LCSB) at the University of Luxembourg, Luxembourg, Luxembourg
Deadline for applications : unknown.
Description :

The Luxembourg Centre for Systems Biomedicine (LCSB) was created within the Health Technologies Initiative from the Government of Luxembourg as one of the research priorities of the University of Luxembourg. The LCSB is an Interdisciplinary Centre of the University that combines experimental and computational approaches to analyse complex biological systems and disease processes. The Computational Biology Group (CBG) provides the LCSB with a solid infrastructure in developing theoretical framework for computational modeling on biomedical problems, especially in the area of network biology in the context of cellular programming/reprogramming. The CBG group includes researchers with theoretical, computational and wet lab backgrounds, thereby providing an unusually interdisciplinary environment.
The Computational Biology Group seeks a highly-skilled Ph.D. student to work on an exciting project on reconstruction and analysis of an integrated gene regulatory network model to elucidate key mechanisms of cellular reprogramming. The model will rely on the integration and mining of diverse transcriptomics and epigenomics data of different cell types from the Central Nervous System. The Ph.D. student is expected to collaborate with other members of the CBG to develop a computational methodology aiming at designing, in-silico, cellular reprogramming events, with a focus on the nervous system. This project will be carried out in collaboration with Prof. Noel Buckleys lab at Kings College London.
Requirements of the ideal candidate:
Master degree in Bioinformatics, Computer Science, Biology or a related discipline
Prior experience in mathematical modelling of biological networks, especially in network inference and analysis
Excellent working knowledge in English.
.
We offer:
Full contract for Ph.D. student for three years with possibility of renewal
Opportunity to do applied research to medical problems within a highly dynamic research institution (LCSB) and in collaboration with internationally recognized partners
An exciting international environment
A very competitive salary

For further information, please contact:

Prof. Dr. Antonio del Sol
E-mail: antonio.delsol@uni.lu

Applications should contain the following documents:
A detailed curriculum vitae
cover letter mentioning the reference number
description of past research experience and future interests
name and addresses of three referees

All applications should be sent preferably in electronic version until December 31st, 2013 to the following address:

Luxembourg Centre for Systems Biomedicine (LCSB)
University of Luxembourg
7, avenue des Hauts-Fourneaux
L-4362 Esch-sur-Alzette
Tel: +352-466644-6982 (Office)
Email: antonio.delsol@uni.lu
http://www.lcsb.lu

• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

Duration: 1 year

Funding Source: Institutional
Salary on grant: B2 (€ 22.000/year gross)
Contact Person (Referent): Tommaso Mazza
Ref. E-Mail: t.mazza@css-mendel.it
Tel: +39 06 44160526
Fax: +39 06 44160548

Job Description: The bioinformatics unit at IRCCS Casa Sollievo della Sofferenza - Mendel laboratory in Rome is looking for one young PhD bioinformatician with specific experience and/or interest in the analysis of transcriptomic data.

The candidate will be mainly in charge of developing research on a range of hot applications and projects, dealing with microarrays, RNA-Seq and miRNA-Seq data. Main activities will be: (i) data analysis (short-reads mapping, variants call and annotation, functional enrichment analysis of gene expression data); (ii) networks analysis and simulation (artificial knockout, redundancy and lethality analysis, gene set essentiality); (iii) developing of ad-hoc software solutions/routines on clusters of CPUs and GPUs.

The correct cultural background (training in Biology / Computer Science / Statistics or a mix of the three) and a strong interest in working with high throughput data analysis will be considered at the same level of specific experience in the above-mentioned fields.
Knowledge of molecular modeling and simulation and one of these languages: python, perl, R, Java, C++, C# is a golden plus. Good knowledge of Scientific English will be positively evaluated for this position, together with good presentation and teamwork skills.

A CV with one professional reference, details on educational background and of the biological and/or bioinformatic and/or data analysis skills and experience should be sent by email for a preliminary selection to: Tommaso Mazza, CSS-Mendel: t.mazza@css-mendel.it

Context
Casa Sollievo della Sofferenza is an Institute for hospitalization, care, and scientific research located in San Giovanni Rotondo, Italy. It integrates clinical assistance (with inpatient and outpatient facilities) and research. It has an affiliate institute, CSS-Mendel, located in Rome. Between the two sites, it employs over 100 researchers who focus on genetics. The Center is equipped with state of the art genomics technology (SOLiD 5500XL next generation sequencer, Illumina MiSeq, Affymetrix/Agilent microarray platforms, etc) as well as a dedicated high performance computing facility, a non-conventional workstation of GPUs and a short- and long-term storage disk.

Applications
Candidates should send:
• a cover letter explaining the role they would like to undertake within the Center, even if it is not listed in this job adv, stating clearly why they would be a good fit to the proposed role, and what they would bring to the Center in terms of expertise, ideas, talent;
• a CV including a list of publications;
• List of referees;

More at http://www.css-mendel.it/

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1