<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/2759?offset=840</link>
	<atom:link href="https://bioinformaticsonline.com/related/2759?offset=840" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6268/project-fellow-national-institute-of-malaria-research</guid>
  <pubDate>Tue, 12 Nov 2013 07:40:51 -0600</pubDate>
  <link></link>
  <title><![CDATA[Project Fellow @ National Institute of Malaria Research]]></title>
  <description><![CDATA[
<p>National Institute of Malaria Research</p>

<p>Sector 8, Dwarka, Delhi -110077</p>

<p>WALK IN INTERVIEW</p>

<p>One position of project fellow is to be filled up in a DRL- funded research project on Molecular and morphological characterization of An. fluviatilis in North-eastern states and bordering areas. The position is purely temporary for one year and can be extended</p>

<p>Essential qualifications</p>

<p>Master’s degree in any branch of Life Sciences with hands on experience in molecular biology and/or bioinformatics.</p>

<p>Age limit: 28 years, (relaxation for SC/ST/OBC candidates as per government of India rules)</p>

<p>Stipend: Rs.12, 000.00 per month (fixed)</p>

<p>Eligible candidates may walk in for an interview on 15 November 2013 at 11 AM at the above mentioned address along with a copy of CV (with a passport size photograph affixed), photocopies of all mark sheets/certificates and originals (for verifications). No TA/DA will be paid for attending the interview .Registration of candidates will start at 10:00AM and end at 10:45 AM.</p>

<p>Advertisement: http://www.mrcindia.org/vacancy/add-4.doc</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/20508/15-highly-motivated-early-stage-researchers-esrsphd-positions</guid>
  <pubDate>Sun, 25 Jan 2015 05:23:53 -0600</pubDate>
  <link></link>
  <title><![CDATA[15 highly motivated Early Stage Researchers (ESRs)/PhD positions]]></title>
  <description><![CDATA[
<p>The MiND programme  looking for 15 highly motivated Early Stage Researchers (ESRs), researchers with a BSc or MSc degree within the first four years (full-time equivalent) of their research career</p>

<p> All applications sent before  2nd of February 2015.</p>

<p>http://www.mind-project.eu/career</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6560/the-graveley-lab</guid>
  <pubDate>Tue, 19 Nov 2013 18:02:48 -0600</pubDate>
  <link></link>
  <title><![CDATA[The Graveley Lab]]></title>
  <description><![CDATA[
<p>Research in the Graveley lab is primarily focused on the regulation of alternative splicing and small RNA mediated gene regulation. These are fascinating and extraordinarily important mechanisms by which genes can be regulated. Our long-term goals are to understand how these processes are regulated at a mechanistic level and to understand the logic of these processes in significant biological settings. To achieve these goals, we strive to think outside the box to creatively attack the problems being addressed using a wide variety of approaches that include biochemistry, genetics, imaging, deep sequencing, large-scale RNAi screening and bioinformatics.</p>

<p>Lab page @ http://graveleylab.cam.uchc.edu/Graveley/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22891/17-marie-curie-phd-position-available-immediately</guid>
  <pubDate>Tue, 23 Jun 2015 06:52:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[17 Marie Curie PhD position available immediately]]></title>
  <description><![CDATA[
<p>Kindly look into following webpage:<br />http://medhealth.leeds.ac.uk/info/1450/scholarships/1795/marie_curie_phd_training_network</p>

<p>The closing date for application will be 26 June 2015.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7153/phd-student-in-computational-systems-biology</guid>
  <pubDate>Tue, 10 Dec 2013 18:46:05 -0600</pubDate>
  <link></link>
  <title><![CDATA[Ph.D. student in Computational Systems Biology]]></title>
  <description><![CDATA[
<p>Ph.D. student in Computational Systems Biology</p>

<p>Location : The Luxembourg Centre for Systems Biomedicine (LCSB) at the University of Luxembourg, Luxembourg, Luxembourg<br />Deadline for applications : unknown.<br />Description :</p>

<p>The Luxembourg Centre for Systems Biomedicine (LCSB) was created within the Health Technologies Initiative from the Government of Luxembourg as one of the research priorities of the University of Luxembourg. The LCSB is an Interdisciplinary Centre of the University that combines experimental and computational approaches to analyse complex biological systems and disease processes. The Computational Biology Group (CBG) provides the LCSB with a solid infrastructure in developing theoretical framework for computational modeling on biomedical problems, especially in the area of network biology in the context of cellular programming/reprogramming. The CBG group includes researchers with theoretical, computational and wet lab backgrounds, thereby providing an unusually interdisciplinary environment.<br />The Computational Biology Group seeks a highly-skilled Ph.D. student to work on an exciting project on reconstruction and analysis of an integrated gene regulatory network model to elucidate key mechanisms of cellular reprogramming. The model will rely on the integration and mining of diverse transcriptomics and epigenomics data of different cell types from the Central Nervous System. The Ph.D. student is expected to collaborate with other members of the CBG to develop a computational methodology aiming at designing, in-silico, cellular reprogramming events, with a focus on the nervous system. This project will be carried out in collaboration with Prof. Noel Buckleys lab at Kings College London.<br />Requirements of the ideal candidate:<br />Master degree in Bioinformatics, Computer Science, Biology or a related discipline<br />Prior experience in mathematical modelling of biological networks, especially in network inference and analysis<br />Excellent working knowledge in English.<br />.<br />We offer:<br />Full contract for Ph.D. student for three years with possibility of renewal<br />Opportunity to do applied research to medical problems within a highly dynamic research institution (LCSB) and in collaboration with internationally recognized partners<br />An exciting international environment<br />A very competitive salary</p>

<p>For further information, please contact:</p>

<p>Prof. Dr. Antonio del Sol<br />E-mail: antonio.delsol@uni.lu</p>

<p>Applications should contain the following documents:<br />A detailed curriculum vitae<br />cover letter mentioning the reference number<br />description of past research experience and future interests<br />name and addresses of three referees</p>

<p>All applications should be sent preferably in electronic version until December 31st, 2013 to the following address:</p>

<p>Luxembourg Centre for Systems Biomedicine (LCSB)<br />University of Luxembourg<br />7, avenue des Hauts-Fourneaux<br />L-4362 Esch-sur-Alzette<br />Tel: +352-466644-6982 (Office)<br />Email: antonio.delsol@uni.lu<br />http://www.lcsb.lu</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6836/research-fellow-mendel-laboratory</guid>
  <pubDate>Tue, 26 Nov 2013 00:07:57 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Fellow @ Mendel laboratory]]></title>
  <description><![CDATA[
<p>IRCCS Casa Sollievo della Sofferenza – Mendel laboratory is seeking one talented bioinformatician (Rome)<br />Start date: immediate</p>

<p>Duration: 1 year</p>

<p>Funding Source: Institutional<br />Salary on grant: B2 (€ 22.000/year gross)<br />Contact Person (Referent): Tommaso Mazza<br />Ref. E-Mail: t.mazza@css-mendel.it<br />Tel: +39 06 44160526<br />Fax: +39 06 44160548</p>

<p>Job Description: The bioinformatics unit at IRCCS Casa Sollievo della Sofferenza - Mendel laboratory in Rome is looking for one young PhD bioinformatician with specific experience and/or interest in the analysis of transcriptomic data.</p>

<p>The candidate will be mainly in charge of developing research on a range of hot applications and projects, dealing with microarrays, RNA-Seq and miRNA-Seq data. Main activities will be: (i) data analysis (short-reads mapping, variants call and annotation, functional enrichment analysis of gene expression data); (ii) networks analysis and simulation (artificial knockout, redundancy and lethality analysis, gene set essentiality); (iii) developing of ad-hoc software solutions/routines on clusters of CPUs and GPUs.</p>

<p>The correct cultural background (training in Biology / Computer Science / Statistics or a mix of the three) and a strong interest in working with high throughput data analysis will be considered at the same level of specific experience in the above-mentioned fields.<br />Knowledge of molecular modeling and simulation and one of these languages: python, perl, R, Java, C++, C# is a golden plus. Good knowledge of Scientific English will be positively evaluated for this position, together with good presentation and teamwork skills.</p>

<p>A CV with one professional reference, details on educational background and of the biological and/or bioinformatic and/or data analysis skills and experience should be sent by email for a preliminary selection to: Tommaso Mazza, CSS-Mendel: t.mazza@css-mendel.it</p>

<p>Context<br />Casa Sollievo della Sofferenza is an Institute for hospitalization, care, and scientific research located in San Giovanni Rotondo, Italy. It integrates clinical assistance (with inpatient and outpatient facilities) and research. It has an affiliate institute, CSS-Mendel, located in Rome. Between the two sites, it employs over 100 researchers who focus on genetics. The Center is equipped with state of the art genomics technology (SOLiD 5500XL next generation sequencer, Illumina MiSeq, Affymetrix/Agilent microarray platforms, etc) as well as a dedicated high performance computing facility, a non-conventional workstation of GPUs and a short- and long-term storage disk.</p>

<p>Applications<br />Candidates should send:<br />• a cover letter explaining the role they would like to undertake within the Center, even if it is not listed in this job adv, stating clearly why they would be a good fit to the proposed role, and what they would bring to the Center in terms of expertise, ideas, talent;<br />• a CV including a list of publications;<br />• List of referees;</p>

<p>More at http://www.css-mendel.it/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7212/bioinformatics-group-at-boku-university</guid>
  <pubDate>Thu, 12 Dec 2013 17:53:10 -0600</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics group at Boku University]]></title>
  <description><![CDATA[
<p>The Bioinformatics group at Boku University has two main areas of interest, underpinning a common goal, the study of complex systems in living organisms. To overcome the engineered redundancies and combinatorial effects prevalent in higher eukaryotes, novel views augmenting the classical gene by gene approaches are required. We combine</p>

<p>1. Work to establish improved quantitative experimental assays (such as microarrays or differential in-gel electrophoresis) and<br />2. Development of modern computational methods (such as hierarchical probabilistic models or integration of heterogeneous data sources)</p>

<p>Lab page @ http://bioinf.boku.ac.at/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</guid>
	<pubDate>Fri, 04 May 2018 19:43:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36483/popular-bioinformatics-educational-resources</link>
	<title><![CDATA[Popular bioinformatics educational resources !]]></title>
	<description><![CDATA[<p>Followings are the list of popular bioinformatics educational resources</p><p><a href="http://Bii.a-star.edu.sg"><strong>Bii.a-star.edu.sg</strong></a></p><p>Bio research and development. Has course information and research information.</p><p><a href="http://Isb-sib.ch"><strong>Isb-sib.ch</strong></a></p><p>SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.</p><p><a href="http://Bioinformatics.ca"><strong>Bioinformatics.ca</strong></a></p><p>Provides information about bioinformatics in Canada. Workshops, certification and resources.</p><p><a href="http://Chickscope.beckman.uiuc.edu"><strong>Chickscope.beckman.uiuc.edu</strong></a></p><p>Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.</p><p><a href="http://Bcb.iastate.edu"><strong>Bcb.iastate.edu</strong></a></p><p>Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).</p><p><a href="http://Bu.edu/bioinformatics/"><strong>Bu.edu/bioinformatics/</strong></a></p><p>Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.</p><p><a href="http://Bioinformatics.ubc.ca"><strong>Bioinformatics.ubc.ca</strong></a></p><p>A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.</p><p><a href="http://Openhelix.com"><strong>Openhelix.com</strong></a></p><p>Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.</p><p><a href="http://Igb.uci.edu"><strong>Igb.uci.edu</strong></a></p><p>Specializing in making publicly available software and database services for computational biology.</p><p><a href="http://Bioinformatics.pe.kr"><strong>Bioinformatics.pe.kr</strong></a></p><p>Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.</p><p><a href="http://Groups.yahoo.com/group/bimatics/"><strong>Groups.yahoo.com/group/bimatics/</strong></a></p><p>Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.</p><p><a href="http://Ncbi.nlm.nih.gov/books/NBK22183/"><strong>Ncbi.nlm.nih.gov/books/NBK22183/</strong></a></p><p>Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.</p><p><a href="http://Bioinfo.mbb.yale.edu/mbb452a/2003/"><strong>Bioinfo.mbb.yale.edu/mbb452a/2003/</strong></a></p><p>Bioinformatics course at Yale University. All course slides are available online.</p><p><a href="http://Cs.iastate.edu/~honavar/comp-bio-courses.html"><strong>Cs.iastate.edu/~honavar/comp-bio-courses.html</strong></a></p><p>Listing of computational molecular biology course pages that have extensive online course materials.</p><p><a href="http://Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html"><strong>Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html</strong></a></p><p>A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.</p><p><a href="http://Northeastern.edu/bioinformatics/"><strong>Northeastern.edu/bioinformatics/</strong></a></p><p>From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.</p><p><a href="http://Biocomp.unibo.it/lsbioinfo/"><strong>Biocomp.unibo.it/lsbioinfo/</strong></a></p><p>A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.</p><p><a href="http://Cs.helsinki.fi/bioinformatiikka/mbi/programme.html"><strong>Cs.helsinki.fi/bioinformatiikka/mbi/programme.html</strong></a></p><p>A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.</p><p><a href="http://Ornl.gov/sci/techresources/Human_Genome/education/education.shtml"><strong>Ornl.gov/sci/techresources/Human_Genome/education/education.shtml</strong></a></p><p>A resource for introductory information on the Human Genome Project.</p><p><a href="http://His.se/bioinformatics"><strong>His.se/bioinformatics</strong></a></p><p>A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.</p><p><a href="http://Members.tripod.com/C.elegans/"><strong>Members.tripod.com/C.elegans/</strong></a></p><p>Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.</p><p><a href="http://Bioinformatics.org/faq/#contents"><strong>Bioinformatics.org/faq/#contents</strong></a></p><p>Summary of basics of bioinformatics for the intelligent newcomer.</p><p><a href="http://Jiscmail.ac.uk/archives/bioinformatics.html"><strong>Jiscmail.ac.uk/archives/bioinformatics.html</strong></a></p><p>Forum featuring various aspects, events and developments in the bioinformatics field.</p><p><a href="http://Biinoida.blogspot.com"><strong>Biinoida.blogspot.com</strong></a></p><p>Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.</p><p><a href="http://Colorbasepair.com/bioinformatics_courses_tutorials.html"><strong>Colorbasepair.com/bioinformatics_courses_tutorials.html</strong></a></p><p>A list of on-line course materials and tutorials for bioinformatics and computational biology.</p><p><a href="http://Geospiza.com/education/"><strong>Geospiza.com/education/</strong></a></p><p>Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.</p><p><a href="http://Bioinformatics.fi"><strong>Bioinformatics.fi</strong></a></p><p>An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.</p><p><a href="http://Perlsource.net"><strong>Perlsource.net</strong></a></p><p>Provides online courses in Perl programming for bioinformatic tools.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>