➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Screen is like a window manager for your console. It will allow you to keep multiple terminal sessions running and easily switch between them. It also protects you from disconnection, because the screen session doesn’t end when you get disconnected.

You’ll need to make sure that screen is installed on the server you are connecting to. If that server is Ubuntu or Debian, just use this command:

sudo apt-get install screen

Now you can start a new screen session by just typing screen at the command line. You’ll be shown some information about screen. Hit enter, and you’ll be at a normal prompt.

To disconnect (but leave the session running)

Hit Ctrl + A and then Ctrl + D in immediate succession. You will see the message [detached]

To reconnect to an already running session

screen -r

To reconnect to an existing session, or create a new one if none exists

screen -D -r

To create a new window inside of a running screen session

Hit Ctrl + A and then C in immediate succession. You will see a new prompt.

To switch from one screen window to another

Hit Ctrl + A and then Ctrl + A in immediate succession.

To list open screen windows

Hit Ctrl + A and then W in immediate succession

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

'du' – Check the size of a directory

$ du
This command ( du) gives you a list of directories that exist in the current working directory along with their sizes in kilobytes (default). The last line of the output gives you the total size of the current directory including its subdirectories.

$ du /home/jin1
The above command would give you the directory size of the directory /home/david

$ du -h
The same “du”command with some flag gives you a better output than the default one. The option '-h' stands for human readable format. Therefore, in order to print the sizes of the files / directories in your desire notation use this time suffixed with a 'k' if its kilobytes and 'M' if its Megabytes and 'G' if its Gigabytes.

$ du -ah
If you are interested in checking everything present in a folder use above mentioned command. It gives us not only the directories but also all the files that are present in the current directory. The “-a” flag displays the filenames along with the directory names in the output.

$ du -c
This gives you a grand total as the last line of the output. So if your directory occupies 30MB the last 2 lines of the output would be 30M.

$ du -s
Use this command to displays a summary of the directory size. It is the simplest way to know the total size of the current directory.

$ du -S
This would display the size of the current directory excluding the size of the subdirectories that exist within that directory. So it basically shows you the total size of all the files that exist in the current directory.

$ du --exculde=mp3
Several times it required to exclude some directory in our size calculation. In such cases the above command would display the size of the current directory along with all its subdirectories, but it would exclude all the files having the given pattern present in their filenames.

'df' - finding the disk free space / disk usage

$ df
Hmmm … now “df” command is really useful, and I guess you are going to use it over time. Typing the above command, outputs a table consisting of 6 columns. All the columns are very easy to understand. Remember that the 'Size', 'Used' and 'Avail' columns use kilobytes as the unit. The 'Use%' column shows the usage as a percentage which is also very useful.

$ df -h
Displays the same output as the previous command but the '-h' indicates human readable format. Hence instead of kilobytes as the unit the output would have 'M' for Megabytes and 'G' for Gigabytes.

Example: Linux installed on /dev/hda1
$ df -h | grep /dev/hda1

All right, this is not the only option to check the sizes and free spaces but there are a few more options that can be used with 'du' and 'df' . I will discuss it later.

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser

(details of experience required)
Pay Scale:
INR Rs.12000/-P.M. + HRA
Category:
Science and Research Jobs
How To Apply:
The interested candidates should report for the Interview on 31st
March, 2014 at 10:00 am in the Conference Room of Dean, School of Biotechnology, First floor, Gautam Buddha University, Greater
Noida. Interested candidates may also send their resume to undersigned by post-mail/e-mail shaktis@gbu.ac.in or shaktisahi@gmail.com. No TA and DA will be paid for appearing for the interview
Download Official Notification:

http://www.gbu.ac.in/Recruitment/JRF_advertisement_DSTProject_Shakti_24March14.pdf

No. CBSH/MBGE/356

Subject: Advertisement for the award of Junior Research Fellowship.

Applications are invited for award of one Junior Research Fellowship on a consolidated fellowship of Rs. 12,000/- pm in the project “Bioinformatics Sub-DIC ”, under the Coordinatorship Dr. Anil Kumar. The fellowship is purely temporary and may continue till the duration of the project or maximum three years which ever is earlier. The appointment shall be given on six monthly review basis.

ESSENTIAL QUALIFICATION

M.Sc. Bioinformatics having research experience on In silico experimentation.

Candidates possessing the above qualifications may submit their application on
plain paper in the following format to the undersigned latest 18 April, 2014 the interviews will be held on 19 April, 2014 at 11.00 AM in the office of the undersigned. No separate letter for interview will be issued or any TA/DA will be paid for attending the interview.

Advertisement: http://www.gbpuat.ac.in/01042014_18april14_Advertisement%20for%20JRF%20Position,%20BI.pdf

Address of the bookmark: https://github.com/rhysf/Synima

Applications are invited from qualified individuals for a JRF/SRF position (sponsored by DBT/DST) at Prof. Jagan Pongubala’s laboratory, University of Hyderabad. Dr. Pongubala’s laboratory is investigating the molecular pathways that control the development of innate and adaptive immune cell types utilizing a combination of genetic, molecular and computational approaches.

JRF/SRF

Masters degree in Bioinformatics (M.Sc./M.Tech.)

Rs. 12,000+HRA
Rs. 16,000+HRA

Initial appointment is for one year and subjected to renewal up to 2 years

Candidates selected for the above position would have a choice to work on computational biology or experimental biology. Candidates interested to work on computational biology are expected to perform high-throughput sequencing (NGS) data analysis and should have a strong background in Bioinformatics & Computational Biology, good programming skills particularly Perl, Python, R and work experience in Linux environment.

Candidates interested to work on experimental biology should have work experience in techniques that are routinely used in molecular biology and mammalian cell culture. A basic knowledge of bioinformatics is also desired.

Applicants for the above positions should have a Masters degree (M.Tech/M.Sc) with an aggregate marks greater than 70% or a 7.5 CGPA. Candidates having JRF-fellowship through CSIR/UGC/ICMR/DBT will be encouraged to enroll into Ph.D. program. The interested candidates having excellent organizational skills and the ability to work in a team environment with an aspiration to learn new techniques and explore new scientific areas are requested to generate their resume using the link https://cvmkr.com/CV/new#0 and forward to pongubalajagan@gmail.com

Review of applications will begin immediately and continue until the position is filled. Eligible candidates will be called for an interview. No TA/ DA will be paid for attending the interview or at the time of joining the post. Applicants should note that the appointment is purely temporary and subjected to renewal up to three years and there is no Right to Claim for any regular appointment with the University.

Corresponding address: Jagan Pongubala, Ph.D.
Department of Animal Sciences
School of Life Sciences, Room:S44
University of Hyderabad
Gachibowli, Hyderabad 500046

Advertisement: https://www.uohyd.ac.in/images/recruitment/jrf-srf_130414.pdf

https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454

Address of the bookmark: http://ani.mypathogen.cn/