<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27818?offset=680</link>
	<atom:link href="https://bioinformaticsonline.com/related/27818?offset=680" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/6715/research-associate-school-of-computational-and-integrative-sciences-under-jawaharlal-nehru-university</guid>
  <pubDate>Fri, 22 Nov 2013 19:06:44 -0600</pubDate>
  <link></link>
  <title><![CDATA[Research Associate@ School of Computational and Integrative Sciences under Jawaharlal Nehru University]]></title>
  <description><![CDATA[
<p>School of Computational and Integrative Sciences under Jawaharlal Nehru University, New Delhi invited applications for filling up 4 posts of Research Associates (RA) and Junior Research Fellow (JRF) (2 posts each)  purely on temporary basis, liable to be terminated at any time without prior notice or ceased/withdrawn by the funding agency. The vacancies are for a Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" (Project ID: 632) being administered by Prof Indira Ghosh. Interested candidates should send their applications till 13 December 2013.<br />Important Dates<br />Last Date for receipt of applications: 13 December 2013<br />Vacancy Details<br />Total Vacancies: 4 posts<br />Type of recruitment: Temporary<br />Sl. No.: 01<br />Name of the Post: Research Associate<br />No of Posts: 1 post<br />Remuneration: Rs.  23000 + 30%<br />Qualifications: PhD in Bioinformatics / computational biology / Biophysics / Physical Chemistry / Computer Science. Computational experience, proven by paper published, is a necessary qualification.<br /> Sl. No.: 02<br />Name of the Post: Research Associate<br />No of Posts: 1 post<br />Remuneration: Rs. 23000 + 30%<br />Qualifications: PhD in Computational Biology / Bioinformatics &amp; related subjects. Computational experience, proven by paper published, is a necessary qualification.<br />Sl. No.: 03<br />Name of the Post: Junior Research Fellow<br />No of Posts: 1 post<br />Remuneration: Rs. 12000 + 30%<br />Qualifications: M. Sc. / B. Tech. preferably in Computational Biology /Bioinformatics and related fields with experience in Website designing &amp; maintenance of Database.<br />Sl. No.: 04<br />Name of the Post: Junior Research Fellow<br />No of Posts: 1 post<br />Remuneration: Rs.  12000 + 30%<br />Qualifications: M. Sc. / MCA / B. Tech. preferably in Computational Biology / Computer science with experience in Programming in Java / Python, C++ etc &amp; designing of Database.<br />Selection Procedure: Selection will be done on the basis of candidates’ performance in the Interview.  <br />Candidates short-listed / selected for Interview will be informed through email only.<br />How to Apply: Interested eligible candidates should send their applications, in the prescribed format, along with their current CV by post to “Prof Indira Ghosh, Project Investigator,  Hall#6, School of Computational and Integrative Sciences,  Jawaharlal Nehru University,  New Delhi-110 067” so as to reach the concerned authority by 13 December 2013.<br />Name of the post applied for’ must be superscripted on the envelope containing the application.<br />NOTE: For the post of Research Associates, only those candidates who have submitted thesis are eligible to apply. However, salary will be provided as per DBT / DST guidelines (i.e. candidates who have qualified NET /BET / BINC will have higher pay scale).<br />Candidates interested to register for PhD may not apply for JRF.<br />More @ http://www.jnu.ac.in/Career/currentjobs.htm</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4653/human-genome-meeting-2014-geneva-switzerland</guid>
  <pubDate>Fri, 20 Sep 2013 12:36:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[Human Genome Meeting 2014, Geneva, Switzerland]]></title>
  <description><![CDATA[
<p>The spectacular advances of the last few years resulted in the rapid analysis of the genome sequence of each individual. The biomedical world is now faced with the enormous challenges of assigning pathogenicity to each genomic variant, the functional analysis of the genome of each individual, and the accurate and detailed phenotypic characterization. Advances in these challenges are likely to fundamentally change the medical practice in a global scale.</p>

<p>This 2014 HUGO Meeting in Geneva will be a Forum for discussions on innovative approaches, and proposals to tackle the anticipated challenges.</p>

<p>Time : 27 April 2014 - 30 April 2014 </p>

<p>For enquiries, please email hugo2014@mci-group.com or visit www.hugo-international.org</p>

<p>More at http://www.hgm2014-geneva.org/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4636/molecular-and-computational-biology-research-school</guid>
  <pubDate>Fri, 20 Sep 2013 09:01:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Molecular and Computational Biology Research School]]></title>
  <description><![CDATA[
<p>The ambition of the Molecular and Computational Biology Research School (MCB) is to create an attractive and stimulating training environment for PhD students in molecular and computational biology, both to better serve the needs for relevant training in the field, and to stimulate crossdiscipline developments in the research of the parties.</p>

<p>http://www.uib.no/rs/mcb</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4888/murray-coxs-genomicus-lab</guid>
  <pubDate>Thu, 26 Sep 2013 16:42:42 -0500</pubDate>
  <link></link>
  <title><![CDATA[Murray Cox's Genomicus Lab]]></title>
  <description><![CDATA[
<p>This group interested in modeling genome dynamics in following topics:</p>

<p>---how genetic variation is distributed within and between individuals, <br />---determining how this diversity changes over evolutionary time.</p>

<p>Hence, Cox group work at the interface between biology, statistics and computer science to address questions of outstanding biological importance through intrepretation of large genetic datasets.</p>

<p>Profile:<br />Associate Professor Murray Cox, <br />Inaugural Rutherford Fellow of the Royal Society of New Zealand,  Principal Investigator in the BioProtection Research Center and Associate Investigator in the Allan Wilson Center for Molecular Ecology and Evolution<br />Email : m.p.cox@massey.ac.nz<br />Webpage: http://massey.genomicus.com/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/5380/04-informatics-approach-to-cancer-interview-with-dr-joel-saltz</guid>
	<pubDate>Mon, 07 Oct 2013 14:35:43 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/5380/04-informatics-approach-to-cancer-interview-with-dr-joel-saltz</link>
	<title><![CDATA[04- Informatics Approach to Cancer - Interview with Dr. Joel Saltz]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/8Kf5EP4LY7k" frameborder="0" allowfullscreen></iframe>For additional information visit http://www.cancerquest.org/joel-saltz-interview.

Dr. Joel Saltz is a Professor in the Departments of Pathology, Biostatistics and Bioinformatics, and Mathematics and Computer Science at
Emory University. Dr. Saltz's research on bioinformatics spans several disciplines.  One project involves applying computer analysis to medical imaging to yield better results for patients.  As an example, a computer program may able to help doctors detect small cancers in a CT scan or mammogram. 

In this interview segment, Dr. Saltz  discusses the informatics approach to cancer.

To learn more about cancer and watch additional interviews, please visit the CancerQuest website at http://www.cancerquest.org.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</guid>
	<pubDate>Fri, 27 Sep 2013 11:28:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</link>
	<title><![CDATA[Evolution and Cancer]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/j3uKOcNwYBw" frameborder="0" allowfullscreen></iframe>Air date:  Wednesday, January 04, 2012, 3:00:00 PM
Time displayed is Eastern Time, Washington DC Local  
 
Category:  Wednesday Afternoon Lectures  
Description:  There is a broad consensus that cancer is the result of somatic cells having serially gained, by a series of mutations, the ability to grow independently, to recruit resources from the circulation and the stroma, to invade local tissues, and to found anatomically distant metastases, ultimately killing the host. From the point of view of the cancer-causing somatic cell population, this is evolution driven by mutation and selection. Genomics has resulted in a parallel consensus that the central functions of all eukaryotes are highly conserved, not only at the level of individual protein functions, but also complex biological pathways and systems. These ideas motivated a comparison between results of molecular genetic studies of experimental evolution in yeast and the molecular genetic phenomena associated with tumorigenesis and tumor progression. We find some very striking similarities, including recurring genomic rearrangements, alterations of the regulation of specific growth-promoting genes, population-genetic features that affect the fitness trajectories of growth rate variants in evolving populations, and physiological and metabolic similarities derived from the conservation of the basic plan of growth and cell multiplication among all eukaryotes. It is hoped that some of the insights from yeast will aid the interpretation of sequence changes found in tumors, especially in the urgent necessity to distinguish 'driver' from 'passenger' mutations." 

David Botstein's fundamental contributions to modern genetics include the development of genetic methods for understanding biological functions and the discovery of the functions of many yeast and bacterial genes. In 1980, Botstein and three colleagues proposed a method for mapping human genes that laid the groundwork for the Human Genome Project. The basic principle of the mapping scheme was to develop, by recombinant DNA techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms when hybridized to restriction digests, or specific fragments, of an individual's DNA. The method was used in subsequent years to identify several human disease genes, such as Huntington's and BRCA1. Variations of this method enabled the sequencing phase of the Human Genome Project. 

In the 1990s Botstein, having moved to Stanford University School of Medicine, collaborated with Patrick O. Brown of Stanford in exploiting DNA microarrays to study genome-wide gene expression patterns in yeast and in human cancers. This required developing a new statistical method and graphical interface, widely used today to interpret genomic data. Botstein also has helped to create, with Michael Ashburner and Gerald Rubin, a bioinformatics initiative to unify the representation of gene and gene product attributes across all species, called Gene Ontology. He graduated from Harvard College and earned his doctorate from the University of Michigan. He worked at Massachusetts Institute of Technology from 1967 to 1988; served as vice president for science at Genentech from 1988 to 1990; chaired the Department of Genetics at the Stanford University School of Medicine from 1990 to 2003; and joined the Princeton University faculty in 2003. He has sat on numerous editorial boards and was the founding editor of Molecular Biology of the Cell. Among recent major awards, Bostein won the Peter Gruber Foundation Prize in Genetics in 2003, the Apple Science Innovator Award in 2008, and the Albany Medical Center Prize in 2010. 

The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. 

For more information, visit: The NIH Director's Wednesday Afternoon Lecture Series  
Author:  Dr. David Botstein, Princeton University  
Runtime:  00:59:58  

Permanent link:  http://videocast.nih.gov/launch.asp?17046]]></description>
	
</item>

</channel>
</rss>