BOL: Related items

Ryan E. Mills Lab

Tue, 26 May 2015 09:29:24 -0500

Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Cogent: a tool for reconstructing the coding genome using high-quality full-length transcriptome sequences.

Jit — Tue, 18 Jun 2019 05:33:04 -0500

Cogent is a tool that identifies gene families and reconstructs the coding genome using high-quality transcriptome data without a reference genome, and can be used to check assemblies for the presence of these known coding sequences.

Cogent is a tool for reconstructing the coding genome using high-quality full-length transcriptome sequences. It is designed to be used on Iso-Seq data and in cases where there is no reference genome or the ref genome is highly incomplete.

See a recent presentation on Cogent being applied to the Cuttlefish Iso-Seq data.

Cogent preliminary draft paper (updated 2016Dec version), Supplementary

Please see wiki for details on usage.

Address of the bookmark: https://github.com/Magdoll/Cogent

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

EFS: an ensemble feature selection tool implemented as R-package and web-application

Jit — Tue, 28 Jan 2020 05:12:23 -0600

The software EFS (Ensemble Feature Selection) makes use of multiple feature selection methods and combines their normalized outputs to a quantitative ensemble importance. Currently, eight different feature selection methods have been integrated in EFS, which can be used separately or combined in an ensemble.

https://biodatamining.biomedcentral.com/articles/10.1186/s13040-017-0142-8

Address of the bookmark: http://efs.heiderlab.de/

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

CAT/BAT: tool for taxonomic classification of contigs and metagenome-assembled genomes (MAGs)

Jit — Mon, 18 May 2020 10:53:32 -0500

Contig Annotation Tool (CAT) and Bin Annotation Tool (BAT) are pipelines for the taxonomic classification of long DNA sequences and metagenome assembled genomes (MAGs/bins) of both known and (highly) unknown microorganisms, as generated by contemporary metagenomics studies. The core algorithm of both programs involves gene calling, mapping of predicted ORFs against the nr protein database, and voting-based classification of the entire contig / MAG based on classification of the individual ORFs. CAT and BAT can be run from intermediate steps if files are formated appropriately (see Usage).

Address of the bookmark: https://github.com/dutilh/CAT

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clustergrammer is a web-based tool for visualizing high-dimensional data as an interactive and shareable hierarchically clustered heatmap

BioStar — Sun, 23 Aug 2020 19:30:17 -0500

Clustergrammer is a web-based tool for visualizing high-dimensional data (e.g. a matrix) as an interactive and shareable hierarchically clustered heatmap. Clustergrammer's front end (Clustergrammer-JS) is built using D3.js and its back-end (Clustergrammer-PY) is built using Python. Clustergrammer produces highly interactive visualizations that enable intuitive exploration of high-dimensional data and has several biology-specific features (e.g. enrichment analysis, see Biology-Specific Features) to facilitate the exploration of gene-level biological data.

Address of the bookmark: https://github.com/MaayanLab/clustergrammer

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

LoReTTA, a user-friendly tool for assembling viral genomes from PacBio sequence data

Neel — Wed, 23 Jun 2021 07:54:53 -0500

LoReTTA (Long Read Template-Targeted Assembler), a tool designed for performing de novo assembly of long reads generated from viral genomes on the PacBio platform. LoReTTA exploits a reference genome to guide the assembly process, an approach that has been successful with short reads.

https://academic.oup.com/ve/article/7/1/veab042/6248116

Address of the bookmark: https://academic.oup.com/ve/article/7/1/veab042/6248116