<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/27967?offset=1260</link>
	<atom:link href="https://bioinformaticsonline.com/related/27967?offset=1260" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37236/installing-salmon-for-trinity</guid>
	<pubDate>Tue, 03 Jul 2018 09:02:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37236/installing-salmon-for-trinity</link>
	<title><![CDATA[Installing Salmon for Trinity !]]></title>
	<description><![CDATA[
<p>➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ conda install salmon<br />Solving environment: done</p>

<p>## Package Plan ##</p>

<p>  environment location: /home/urbe/anaconda3</p>

<p>  added / updated specs: <br />    - salmon</p>

<p>The following packages will be downloaded:</p>

<p>    package                    |            build<br />    ---------------------------|-----------------<br />    boost-1.64.0               |           py36_4         331 KB  conda-forge<br />    jemalloc-5.1.0             |       hfc679d8_0         8.2 MB  conda-forge<br />    boost-cpp-1.64.0           |                1        17.8 MB  conda-forge<br />    salmon-0.10.2              |                1         3.7 MB  bioconda<br />    conda-4.5.5                |           py36_0         624 KB  conda-forge<br />    tbb-2018_20171205          |                0         1.2 MB  conda-forge<br />    ------------------------------------------------------------<br />                                           Total:        31.8 MB</p>

<p>The following NEW packages will be INSTALLED:</p>

<p>    boost:     1.64.0-py36_4    conda-forge<br />    boost-cpp: 1.64.0-1         conda-forge<br />    jemalloc:  5.1.0-hfc679d8_0 conda-forge<br />    salmon:    0.10.2-1         bioconda   <br />    tbb:       2018_20171205-0  conda-forge</p>

<p>The following packages will be UPDATED:</p>

<p>    conda:     4.5.4-py36_0     conda-forge --&gt; 4.5.5-py36_0 conda-forge</p>

<p>Proceed ([y]/n)? y</p>

<p>Downloading and Extracting Packages<br />boost-1.64.0         |  331 KB | ####################################################################################################################################### | 100% <br />jemalloc-5.1.0       |  8.2 MB | ####################################################################################################################################### | 100% <br />boost-cpp-1.64.0     | 17.8 MB | ####################################################################################################################################### | 100% <br />salmon-0.10.2        |  3.7 MB | ####################################################################################################################################### | 100% <br />conda-4.5.5          |  624 KB | ####################################################################################################################################### | 100% <br />tbb-2018_20171205    |  1.2 MB | ####################################################################################################################################### | 100% <br />Preparing transaction: done<br />Verifying transaction: done<br />Executing transaction: done</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37514/list-of-non-commercial-ngs-genotype-calling-software</guid>
	<pubDate>Thu, 09 Aug 2018 04:21:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37514/list-of-non-commercial-ngs-genotype-calling-software</link>
	<title><![CDATA[List of non-commercial NGS genotype-calling software]]></title>
	<description><![CDATA[<p><span>Meaningful analysis of next-generation sequencing (NGS) data, which are produced extensively by genetics and genomics studies, relies crucially on the accurate calling of SNPs and genotypes. Recently developed statistical methods both improve and quantify the considerable uncertainty associated with genotype calling, and will especially benefit the growing number of studies using low- to medium-coverage data.&nbsp;</span></p><p><span>A list of programs for genotype and SNP calling :</span></p><p><br />SOAP2&nbsp;http://soap.genomics.org.cn/index.html</p><p>Single-sample High-quality variant database (for example, dbSNP) Package for NGS data analysis, which includes a single individual genotype caller (SOAPsnp)</p><p>realSFS&nbsp;http://128.32.118.212/thorfinn/realSFS/</p><p>Single-sample Aligned reads Software for SNP and genotype calling using single individuals and allele frequencies. Site frequency spectrum (SFS) estimation</p><p>Samtools http://samtools.sourceforge.net/</p><p>Multi-sample Aligned reads Package for manipulation of NGS alignments, which includes a computation of genotype likelihoods (samtools) and SNP and genotype calling (bcftools)</p><p>GATK http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit Multi-sample Aligned reads Package for aligned NGS data analysis, which includes a SNP and genotype caller (Unifed Genotyper), SNP filtering (Variant Filtration) and SNP quality recalibration (Variant Recalibrator)</p><p>Beagle http://faculty.washington.edu/browning/beagle/beagle.html</p><p>Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation, phasing and association that includes a mode for genotype calling</p><p>IMPUTE2 http://mathgen.stats.ox.ac.uk/impute/impute_v2.html</p><p>Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation and phasing, including a mode for genotype calling. Requires fine-scale linkage map</p><p>QCall ftp://ftp.sanger.ac.uk/pub/rd/QCALL</p><p>Multi-sample LD &lsquo;Feasible&rsquo; genealogies at a dense set of loci, genotype likelihoods Software for SNP and genotype calling, including a method for generating candidate SNPs without LD information (NLDA) and a method for incorporating LD information (LDA). The &lsquo;feasible&rsquo; genealogies can be generated using Margarita (http://www.sanger.ac.uk/resources/software/margarita)</p><p>MaCH http://genome.sph.umich.edu/wiki/Thunder</p><p>Multi-sample LD Genotype likelihoods Software for SNP and genotype calling, including a method (GPT_Freq) for generating candidate SNPs without LD information and a method (thunder_glf_freq) for incorporating LD information</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38169/amstat-display-statistics-of-large-sequence-files-from-next-generation-sequencing-projects</guid>
	<pubDate>Fri, 09 Nov 2018 13:34:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38169/amstat-display-statistics-of-large-sequence-files-from-next-generation-sequencing-projects</link>
	<title><![CDATA[AMStat: display statistics of large sequence files from next generation sequencing projects]]></title>
	<description><![CDATA[<p><span>SAMStat is an efficient C program to quickly display statistics of large sequence files from next generation sequencing projects. When applied to&nbsp;</span><a href="http://samstat.sourceforge.net/#about">SAM/BAM</a><span>&nbsp;files all statistics are reported for unmapped, poorly and accurately mapped reads separately. This allows for identification of a variety of problems, such as remaining linker and adaptor sequences, causing poor mapping. Apart from this SAMStat can be used to verify individual processing steps in large analysis pipelines.</span></p><p>Address of the bookmark: <a href="http://samstat.sourceforge.net/" rel="nofollow">http://samstat.sourceforge.net/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39674/simka-and-simkamin-are-comparative-metagenomics-method-dedicated-to-ngs-datasets</guid>
	<pubDate>Sat, 06 Jul 2019 13:56:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39674/simka-and-simkamin-are-comparative-metagenomics-method-dedicated-to-ngs-datasets</link>
	<title><![CDATA[Simka and SimkaMin are comparative metagenomics method dedicated to NGS datasets]]></title>
	<description><![CDATA[<p>Simka is a de novo comparative metagenomics tool. Simka represents each dataset as a k-mer spectrum and compute several classical ecological distances between them.</p>
<p>Developper:&nbsp;<a href="http://people.rennes.inria.fr/Gaetan.Benoit/">Ga&euml;tan Benoit</a>, PhD, former member of the&nbsp;<a href="http://team.inria.fr/genscale/">Genscale</a>&nbsp;team at Inria.</p>
<p>Contact: claire dot lemaitre at inria dot fr</p>
<p><span>Simka and SimkaMin are comparative metagenomics method dedicated to NGS datasets.&nbsp;</span><span></span><span><a href="https://gatb.inria.fr/software/simka/">https://gatb.inria.fr/software/simka/</a></span></p><p>Address of the bookmark: <a href="https://github.com/GATB/simka" rel="nofollow">https://github.com/GATB/simka</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40770/scientist-bioinformatics-positions</guid>
  <pubDate>Thu, 30 Jan 2020 06:53:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist Bioinformatics Positions]]></title>
  <description><![CDATA[
<p>Bioinformatics-Multi_Omics_Integration</p>

<p>https://www.researchgate.net/job/939073_Senior_Scientist_Bioinformatics-Multi_Omics_Integration</p>

<p> <br />Senior_Scientist_Bioinformatics-Transcriptomics_Analysis     </p>

<p>https://www.researchgate.net/job/939075_Senior_Scientist_Bioinformatics-Transcriptomics_Analysis-Belgium_France_Switzerland_The_Netherlands</p>

<p>Senior Scientist Bioinformatics - Network Analytics</p>

<p>https://www.researchgate.net/job/939070_Senior_Scientist_Bioinformatics-Network_Analytics_Belgium_France_Switzerland_the_Netherlands</p>

<p>Team Leader Bioinformatics Data Sciences - Mechelen, Belgium</p>

<p>https://www.researchgate.net/job/938787_Team_Leader_Bioinformatics_Data_Sciences-Mechelen_Belgium</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42329/10-ngs-services-companies-around-the-globe</guid>
	<pubDate>Sun, 22 Nov 2020 23:56:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42329/10-ngs-services-companies-around-the-globe</link>
	<title><![CDATA[10 NGS services companies around the globe !]]></title>
	<description><![CDATA[<p><strong>The global&nbsp;NGS services market&nbsp;is expected to reach USD 13.1 billion by 2025.&nbsp;</strong>Here are the&nbsp;<strong style="font-size: 12.8px;">top 10 NGS services companies to look for &ndash;</strong></p><p><strong>1.&nbsp;<a href="https://www.illumina.com/">Illumina, Inc. (U.S.)</a></strong></p><p>Illumina, Inc. was founded in 1998 and is headquartered at San Diego, U.S. Illumina, Inc. is one of the leading players in DNA sequencing and array-based technologies, serving customers in the research, clinical, and applied markets. The company offers products for applications in the life sciences, oncology, reproductive health, agriculture, and other emerging segments. The company serves government laboratories, genomic research centers, academics institutions as well as pharmaceutical, biotechnology, agrigenomics, commercial molecular diagnostics laboratories and consumer genomics companies. Illumina, Inc. has its geographic presence in North America, Europe, Latin America, Asia-pacific, and others.</p><p><strong>2.&nbsp;<a href="https://www.qiagen.com/us/">QIAGEN N.V. (Netherlands)</a></strong></p><p>QIAGEN N.V. was incorporated in 1986 and is headquartered at Venlo, The Netherlands. The Company is engaged in providing Sample to Insight solutions that transform biological samples into molecular insights. QIAGEN provides its workflow to customers in molecular diagnostics, assay technologies, bioservices and automation systems.&nbsp; The company&rsquo;s genome services are suitable for custom/tailored projects that allow access to genomic sequence information.&nbsp; The Company market its products in more than 100 countries across the Americas, Europe, Asia, Australia, and the Middle-East &amp;Africa through its subsidiaries and channel partners.</p><p><strong>3.&nbsp;<a href="https://www.perkinelmer.com/">PerkinElmer, Inc. (U.S.)</a></strong></p><p>PerkinElmer, Inc. was founded in 1947 and is headquartered in Waltham, Massachusetts, the U.S. PerkinElmer, Inc. offers its products &amp; services and solutions for the diagnostics, food, environmental, industrial, life sciences research and laboratory services markets. The company offer comprehensive genetic testing solutions that help to provide insight into the complex nature of rare and inherited diseases. Some of the subsidiaries of the company are Caliper Life Sciences, Improvision, Viacell Inc., ViaCord LLC, among many others. The company has its facilities located in Europe (France, Germany, and Belgium), U.S. and Asia (China, India, and Japan).</p><p><strong>4.&nbsp;<a href="https://www.eurofins.com/">Eurofins Scientific SE (Luxembourg)</a></strong></p><p>Eurofins Scientific SE was founded in 1987 and is headquartered in Luxembourg, Europe. The company offers a portfolio of over 130,000 analytical methods and more than 150 million assays performed each year to establish the safety, identity, composition, authenticity, origin, traceability, and purity of biological substances and products, as well as carry out human diagnostic services. The company has its geographic presence across 39 countries in Europe, North and South America, and Asia-Pacific.</p><p><strong>5.&nbsp;<a href="https://www.gatc-biotech.com/en/index.html">GATC Biotech AG (Germany)</a></strong></p><p>GATC Biotech AG was founded in 1990 and is headquartered in Constance, Germany. The company provides DNA and RNA sequencing and bioservices solutions to academics and industrial areas. It also provides next generation sequencing services including genomes, targeted (re)-sequencing, human sample sequencing, transcriptomes, metagenomes, regulomes, pre-sequencing, NGS barcode labels, and next generation sequencing technologies; and bioservices services, including bioservices tools, pipelines and workflows, compute resources, data analysis reports, and case studies. GATC Biotech AG operates as a subsidiary of Eurofins Scientific SE. It offers its products through distributors in Italy, Japan, Portugal, Spain, and the Czech Republic.</p><p><strong>6.<a href="https://www.macrogen.com/">&nbsp;Macrogen, Inc. (South Korea)</a></strong></p><p>Macrogen, Inc. was founded in 1997 and is headquartered in Seoul, South Korea. Macrogen, Inc. provides next generation sequencing services such as whole genome, de novo, exome, targeted, transcriptomics, metagenome, and epigenome sequencing.&nbsp; The company also provides a variety of services such as oligo synthesis, database construction, genome research, and bioservices analysis system consulting services. Macrogen, Inc. provides genome research services in Korea and internationally.</p><p><strong>7.&nbsp;<a href="https://www.genotypic.co.in/">Genotypic Technology Pvt. Ltd. (India)</a></strong></p><p>Genotypic Technology Pvt. Ltd. was incorporated in 1998 and is headquartered in Bangalore, India. Genotypic Technology is the first Genomics service provider in India providing Microarray, Next Generation Sequencing (NGS), Bioservices and solutions to domestic/ international pharma, biotech companies and academia. The company provides its services for protocol optimization, probe designing, array layouts, project designing, and nucleic acid analysis to in-depth analysis. Genotypic Technology has its geographic presence in North America, Europe, Asia Pacific, Middle East &amp; Africa, and Latin America.</p><p><strong>8.&nbsp;<a href="https://www.genewiz.com/">GENEWIZ, Inc. (U.S.)</a></strong></p><p>GENEWIZ, Inc. was founded in 1999 and is headquartered in South Plainfield, New Jersey, the U.S.; The company is a leading provider of research service in the field of Next Generation Sequencing, Sanger DNA sequencing, sequencing of bacteria and phage, gene synthesis, DNA cloning, genomics including mutation analysis, single nucleotide polymorphism, and bioservices. GENEWIZ, Inc. has its geographic presence in U.S., China, Germany, France, Japan, and the U.K.</p><p><strong>9.&nbsp;<a href="https://www.genomics.cn/">Beijing Genomics Institute (China)</a></strong></p><p>Beijing Genomics Institute (BGI) is the world&rsquo;s largest genomics organization and non-profit research institution that was founded in 1999 and is headquartered in Shenzhen, China. The Company provides a wide range of commercial next generation sequencing services and genetic tests for medical institutions, agricultural and environmental applications. The Company operates all across the globe through its subsidiaries, namely, BGI China (Mainland), BGI Asia Pacific, BGI Americas (North and South America) and BGI Europe (Europe and Africa).</p><p><strong>10.&nbsp;<a href="https://www.scigenom.com/">SciGenom Labs Pvt. Ltd (India)</a></strong></p><p>SciGenom Labs Pvt. Ltd was founded in 2010 and is headquartered in Cochin, India with offices in Chennai &amp; Hyderabad in India, and San Francisco in the U.S. It is a Genomics R&amp;D services company that provides genomic sequencing and NGS services to life sciences and healthcare businesses globally as well as academic and government institutions in India.</p><p>Popular mentions &ndash; MedGenome (India), DNA Link, Inc. (South Korea), Otogenetics Corporation (U.S.), Novogene Corporation (China), LGC Limited (U.K.), CD Genomics (U.S.), SeqLL, LLC (U.S.)</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>