<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28141?offset=350</link>
	<atom:link href="https://bioinformaticsonline.com/related/28141?offset=350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/10659/gps-dna-tracking-university-of-sheffield</guid>
	<pubDate>Sat, 10 May 2014 04:33:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/10659/gps-dna-tracking-university-of-sheffield</link>
	<title><![CDATA[GPS DNA tracking - University of Sheffield]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/Aap-s1kle4Q" frameborder="0" allowfullscreen></iframe>University of Sheffield geneticist and bioinformatics expert Dr Eran Elhaik demonstrates the power of his new DNA research, which allows people to discover their genetic homeland from 1000 years ago. Find out more about our biological research here http://www.sheffield.ac.uk/aps]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/783/perl-module-installation</guid>
	<pubDate>Fri, 12 Jul 2013 11:19:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/783/perl-module-installation</link>
	<title><![CDATA[Perl Module Installation]]></title>
	<description><![CDATA[<p>Nice step wide information on perl module installation.</p><p>Address of the bookmark: <a href="http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways" rel="nofollow">http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10741/managing-and-analyzing-next-generation-sequence-data</guid>
	<pubDate>Sat, 10 May 2014 06:28:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10741/managing-and-analyzing-next-generation-sequence-data</link>
	<title><![CDATA[Managing and Analyzing Next-Generation Sequence Data]]></title>
	<description><![CDATA[<p>Centralized Bioinformatics Core Facilities provide shared resources for the computational and IT requirements of the investigators in their department or institution. As such, they must be able to effectively react to new types of experimental technology. Recently faced with an unprecedented flood of data generated by the next generation of DNA sequencers, these groups found it necessary to respond quickly and efficiently to the informatics and infrastructure demands. Centralized Facilities newly facing this challenge need to anticipate time and design considerations of necessary components, including infrastructure upgrades, staffing, and tools for data analyses and management ...</p>
<p>More at http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369</p><p>Address of the bookmark: <a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369" rel="nofollow">http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</guid>
	<pubDate>Wed, 14 Aug 2013 14:57:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</link>
	<title><![CDATA[Citrus Perl]]></title>
	<description><![CDATA[<p>Citrus Perl is a binary distribution of Perl created for GUI application developers. The distribution includes <a href="http://wxperl.sourceforge.net">wxPerl</a>, the Perl wrapper for <a href="http://www.wxwidgets.org">wxWidgets</a>. Where supported by the operating system wxWidgets is available as a package for the 2.8.x stable branch and the 2.9.x development branch.</p><p>Address of the bookmark: <a href="http://www.citrusperl.com/" rel="nofollow">http://www.citrusperl.com/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12593/visiting-scientist-computational-genomics-two-positions</guid>
  <pubDate>Mon, 07 Jul 2014 22:53:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[Visiting Scientist - Computational Genomics (two positions)]]></title>
  <description><![CDATA[
<p>Scientific/Managerial &amp; International Recruitment</p>

<p>ICRISAT seeks applications from Indian nationals Visiting Scientist-Computational Genomics (2 positions), to be part of a team of Centre of Excellence in Genomics (CEG), (www.icrisat.org/ceg) to work on legume genomics projects.  The positions will be based at ICRISAT’s Headquarters in Patancheru, Hyderabad, India.</p>

<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these are the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture. ICRISAT is headquartered in Greater Hyderabad, Andhra Pradesh, India and belongs to the Consortium of Centers supported by the Consultative Group on International Agricultural Research (CGIAR).</p>

<p>The Job: Responsibilities for these positions include:</p>

<p>    Analyzing and handling large-scale next generation sequencing DNA and RNA data<br />    Data mining and development of pipelines and troubleshooting<br />    Genome diversity analysis such as SNPs, Indels, Structural Variations, population structure<br />    Genome wide association study (GWAS) related analysis- LD analysis, hapmap and trait mapping<br />    Expression analysis based on RNA-Seq data, annotation, gene ontology and metabolic pathway analysis<br />    Epigenome analysis, small RNA identification<br />    Gene family analysis, sequence level protein analysis, orthology/paralogy and molecular modelling<br />    Compiling and analysis of results, writing reports and research papers</p>

<p>The Person:  Ph.D. or MSc/MTech/PGDCA with two years research experience in Biotechnology, Computational biology, Agricultural/ Plant Biotechnology, Genetics, Molecular Biology or related discipline. Good knowledge of programming/scripting in at least two of following languages: Perl, C, C++, R, Shell Scripting and Python is plus.</p>

<p>How to apply: Please apply latest by 20 July 2014.  The application should include the name of the position applied for, a letter of motivation, a full Curriculum Vita (CV), and the names and contact information of three references that are knowledgeable of the candidate’s professional qualifications and work experience. Technical details and more information about these positions can be obtained from R.K.VARSHNEY@CGIAR.ORG. All applications will be acknowledged, however only short listed candidates will be contacted.</p>

<p>Apply here https://recruit.zoho.com/ats/Portal.na?digest=T642sgLYWZOStExJ77cPrcM*sIMGZETWw4yPxngbmHA-</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</guid>
	<pubDate>Thu, 26 Sep 2013 15:02:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</link>
	<title><![CDATA[Detect the sequence pattern and its location in fasta file with match and mismatches information.]]></title>
	<description><![CDATA[<p>This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..</p><p>To run:</p><p>perl centro.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4882" length="3596" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</guid>
	<pubDate>Sat, 31 May 2014 14:31:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</link>
	<title><![CDATA[Stephen Friend: The hunt for "unexpected genetic heroes"]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/Yagdvqn2YMU" frameborder="0" allowfullscreen></iframe>What can we learn from people with the genetics to get sick — who don't? With most inherited diseases, only some family members will develop the disease, while others who carry the same genetic risks dodge it. Stephen Friend suggests we start studying those family members who stay healthy. Hear about the Resilience Project, a massive effort to collect genetic materials that may help decode inherited disorders.

TEDTalks is a daily video podcast of the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and much more.
Find closed captions and translated subtitles in many languages at http://www.ted.com/translate

Follow TED news on Twitter: http://www.twitter.com/tednews
Like TED on Facebook: https://www.facebook.com/TED

Subscribe to our channel: http://www.youtube.com/user/TEDtalksDirector]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>