<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/28141?offset=400</link>
	<atom:link href="https://bioinformaticsonline.com/related/28141?offset=400" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</guid>
	<pubDate>Sat, 31 May 2014 14:31:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11311/stephen-friend-the-hunt-for-unexpected-genetic-heroes</link>
	<title><![CDATA[Stephen Friend: The hunt for "unexpected genetic heroes"]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/Yagdvqn2YMU" frameborder="0" allowfullscreen></iframe>What can we learn from people with the genetics to get sick — who don't? With most inherited diseases, only some family members will develop the disease, while others who carry the same genetic risks dodge it. Stephen Friend suggests we start studying those family members who stay healthy. Hear about the Resilience Project, a massive effort to collect genetic materials that may help decode inherited disorders.

TEDTalks is a daily video podcast of the best talks and performances from the TED Conference, where the world's leading thinkers and doers give the talk of their lives in 18 minutes (or less). Look for talks on Technology, Entertainment and Design -- plus science, business, global issues, the arts and much more.
Find closed captions and translated subtitles in many languages at http://www.ted.com/translate

Follow TED news on Twitter: http://www.twitter.com/tednews
Like TED on Facebook: https://www.facebook.com/TED

Subscribe to our channel: http://www.youtube.com/user/TEDtalksDirector]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12896/inspire-faculty-scheme-a-component-of-%E2%80%9Cassured-opportunity-for-research-career-aorc%E2%80%9D-under-inspire</guid>
  <pubDate>Sat, 19 Jul 2014 14:59:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.]]></title>
  <description><![CDATA[
<p>Ministry of Science and Technology, Department of Science and Technology</p>

<p>7th ADVERTISEMENT – 2014 (2)</p>

<p>INSPIRE Faculty Scheme: a component of “Assured Opportunity for Research Career (AORC)” under INSPIRE.</p>

<p>The Department of Science and Technology, Government of India, has launched the “Innovation in Science Pursuit for Inspired Research (INSPIRE)” [http://www.inspire-dst.gov.in] program in 2008.</p>

<p>The program aims to attract talent for study of science and careers with research. INSPIRE includes many components. The importance of Assured Career Opportunity in R&amp;D sector has been recognized.</p>

<p>INSPIRE Faculty Scheme opens up an “Assured Opportunity for Research Career (AORC)” for young researchers in the age group of 27-32 years. It offers a contractual research awards to young achievers and opportunity for independent research in the near term and emerge as a future leader in the long term.</p>

<p>Eligibility</p>

<p>Essential Indian citizens and people of Indian origin including NRI/PIO status with PhD (in science, mathematics, engineering, pharmacy, medicine, and agriculture related subjects) from any recognized university in the world,</p>

<p>Those who have submitted their PhD Theses and are awaiting award of the degree are also<br />eligible. However, the award will be conveyed only after confirmation of the awarding the<br />PhD degree.</p>

<p>The upper age limit as on 1st July 2014 should be 32 years for considering support for a<br />period of 5 years. However, for SC and ST candidates, upper age limit will be 35 years.</p>

<p>Publication(s) in highly reputed Journals demonstrating research potential of the candidate.</p>

<p>Desirable</p>

<p>Candidates who are within top 1% at the School Leaving Examination, IIT-JEE rank, 1st Rank Holder either in graduation or post-graduation level university examination (which are used presently for identifying INSPIRE Scholars at under-graduate level and INSPIRE Fellows for doctoral degree)</p>

<p>More at http://www.inspire-dst.gov.in/faculty_scheme.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</guid>
	<pubDate>Sun, 08 Jun 2014 02:47:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/11603/ncbi-webinar</link>
	<title><![CDATA[NCBI Webinar]]></title>
	<description><![CDATA[<p>In less than two weeks, NCBI will offer a webinar entitled "Introducing 3 NCBI Resources to Navigate Testing for Disease Linked Variants: MedGen, GTR and ClinVar". This webinar will delve into the lifecycle of genetic testing and teach attendees how to navigate the NIH Genetic Testing Registry, ClinVar, and MedGen resources. These resources can be used to prepare for clinical cases, access detailed information about orderable genetic tests, interpret test results, and more.</p><p>More at https://attendee.gotowebinar.com/register/8452228815737989634</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</guid>
	<pubDate>Tue, 28 Jan 2020 05:37:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</link>
	<title><![CDATA[The Raku Programming Language]]></title>
	<description><![CDATA[<p><span>Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.</span><span>&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://www.raku.org/">https://www.raku.org/</a></span></p><p>Address of the bookmark: <a href="https://www.raku.org/" rel="nofollow">https://www.raku.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12111/internship-program-with-arraygen-technolgies</guid>
  <pubDate>Sun, 22 Jun 2014 23:18:31 -0500</pubDate>
  <link></link>
  <title><![CDATA[Internship program with ArrayGen Technolgies]]></title>
  <description><![CDATA[
<p>Internship Program for Bioinformatics / Biotechnology Professionals Currently we offer positions to outstanding students interested in Next Generation Sequencing (NGS) data analysis. Applications are accepted throughout the year. Accepted students will be listed on web with their schedules. Accepted students can attend our future workshops and trainings freely at the specified venue.</p>

<p>Interested candidates may email their resume along with a cover letter to careers@arraygen.com</p>

<p>Official website: http://www.arraygen.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</guid>
	<pubDate>Sat, 27 Feb 2021 01:42:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</link>
	<title><![CDATA[Run bash script in Perl program !]]></title>
	<description><![CDATA[<p>BioPerl is a compilation of Perl modules that can be used to build bioinformatics-related Perl scripts. It is used, for example, in the development of source codes, standalone software/tools, and algorithms in bioinformatics programmes. Different modules are easy to instal and include, making it easier to perform different functions. Despite the fact that Python is commonly favoured over Perl, some bioinformatics software, such as the standalone version of 'alienomics', is written in Perl. Often it's a major problem for beginners to execute certain Unix/shell commands in Perl script, so it's hard to determine which feature is unique to a situation.</p><div style="background-color: white;">Perl provides various features and operators for the execution of external commands (described as follows), which are unique in their own way.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;">They vary slightly from one another, making it difficult for Perl beginners to choose between them.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;"><strong>1. IPC::Open2</strong></div><p>More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module</p><p><strong>2. exec&rdquo;&rdquo;</strong></p><p><em>&nbsp;syntax:&nbsp;</em><code>exec "command";</code></p><div style="background-color: #edfbff;">It's a Perl function (perlfunc) that executes a command but never returns, similar to a function's return statement.</div><div style="background-color: white;">While running the command, it keeps processing the script and does not wait until it finishes first, returns false when the command is not found, but never returns true.</div><p><strong>3. Backticks &ldquo; or qx//</strong></p><p><em>syntax:&nbsp;</em><code>`command`;</code></p><p><em>syntax:&nbsp;</em><code>qx/command/;</code></p><div style="background-color: white;">It's a Perl operator (perlop) that executes a command and then resumes the Perl script once the command has ended, but the return value is the command's STDOUT.</div><p><strong>4. IPC::Open3</strong></p><p><em>syntax:&nbsp;</em><code>$output =&nbsp;open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR,&nbsp;'command arg1 arg2', 'optarg',...);</code></p><p style="text-align: justify;"><code></code>It is very similar to <code>IPC::Open2</code> with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: <a href="https://perldoc.perl.org/IPC/Open3.html" target="_blank">IPC::Open3</a>.</p><p><code>$output = open3(my $o ut,&nbsp;my $in, 'command arg1 arg2');</code></p><p>OR without using the shell</p><p><code>$output = open3(my $out,&nbsp;my $in, 'command', 'arg1', 'arg2');</code></p><p><strong>5.a2p</strong></p><p><em>syntax:&nbsp;</em><code>a2p [options] [awkscript]</code></p><p>There is a Perl utility known as <code>a2p</code> which translates <code>awk</code> command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following <code>awk</code> statement</p><p><code>awk '{$1 = ""; $2 = ""; print}' f1.txt</code></p><p>This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using <code>a2p</code> it can be easily converted to Perl script:</p><p>For further information, you can read it&rsquo;s documentation: <code><a href="https://perldoc.perl.org/a2p.html" target="_blank">a2p</a></code></p><p>More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl</p><p><strong>6. system()</strong></p><p><em>syntax:&nbsp;</em><code>system( "command" );</code></p><p>It is also a Perl function (<a href="https://perldoc.perl.org/functions/system.html" target="_blank">perlfunc</a>) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:</p><p><code>system( "command arg1 arg2" );</code></p><p>OR</p><p><code>system( "command", "arg1", "arg2" );</code></p><p>HELP</p><p>Here are some useful Perl cheat sheets that can be used as a quick reference guide.--&nbsp;<a href="https://www.pcwdld.com/perl-cheat-sheet" target="_blank">https://www.pcwdld.com/perl-cheat-sheet</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12566/jrf-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Fri, 04 Jul 2014 13:36:02 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY</p>

<p>New Delhi-110012</p>

<p>Walk in interview</p>

<p>Eligible candidates may appear for Walk-in interview for the temporary positions of JRF/SRF/ RA, in ICAR, DBT funded research projects. Positions are purely temporary in nature and are co-terminus with the projects. The initial appointment will be for maximum one year, which can be extended on the basis of assessment of the candidate performance and need in the project work (PI-Dr. N. K. Singh, National Professor).</p>

<p>Name of the</p>

<p>PI (Project)<br />	</p>

<p>Name of</p>

<p>Position<br />	</p>

<p>Number of</p>

<p>positions<br />	</p>

<p>Emoluments</p>

<p>Fixed per</p>

<p>month (Rs.)<br />	</p>

<p>Essential</p>

<p>Qualifications</p>

<p>DBT-“Physical Mapping and Sample sequencing of Wheat Chromosome 2A- International Wheat Genome Sequencing Consortium (India)”.</p>

<p>(Up to Nov,2014)</p>

<p>DBT- Identification and functional analysis of genes related to yield and biotic stresses (Up to Oct,2014)</p>

<p>NPTC-Central Facility<br />	</p>

<p>RA (Master)</p>

<p>JRF/SRF</p>

<p>Research Associate: One</p>

<p>Essential: MCA or M. Tech. (Bioinformatics and computer Science with 2 years experience in Database Management with</p>

<p>MySQL, Linux)</p>

<p>Desirable: Proficiency in handling of large biological databases</p>

<p>Age limit: Max. Age 35 years (Age of relaxation of 5 years for SC/ST&amp; woman. and 3 years for OBC). The interview will be held on 08 July, 2014 at 11 am at room no. 39, NRCPB, LBS Building, Pusa Campus, New Delhi-110012. The candidates must bring original certificates and four copies of biodata, and recent passport size photograph. No TA/DA would be given for the appearance in interview. Only the candidates having essential qualifications would be entertained for the interviews.</p>

<p>Advertisement:</p>

<p>www.nrcpb.org/sites/default/files/news%20paper%20advirtisment..docx</p>
]]></description>
</item>

</channel>
</rss>